EJBiotechnology logo
Electronic Journal of Biotechnology ISSN: 0717-3458
  © 2011 by Universidad Católica de Valparaíso -- Chile
Vol. 14 No. 2, Issue of April 15, 2011
 

Table 2. Characterization of genic SSR markers in L. usitatissimum and their transferability to 11 Linum species.



Bank accession n°

Locus name

Primer sequence (5’→3’)

Repeat motif

Expected size bp

N° alleles

PIC

Transferability to Linum species

L. b.

L. p.

L.a.

L. g.

L. n.

L.l.

L. h.

L.t.

L.s.

L.ta.

L. f.

N° putative alleles

Multi loci*

EX720235.1

LM-42

GAATGAGGAACACCGGAAAG
ATCCAAGTGAACTTGCCTCC

(CCA)5

163

2

0.28

+

+

+

+

+

+

-

+

+

-

+

4

-

EX720209.1

LM-43

GCTGACGAAGGAGAAGGAAG
CATACGCAAAAGGAGAAGGC

(GGA)5

172

3

0.55

+

+

+

+

+

-

+

+

+

-

+

4

-

EX720185.1

LM-44

AACCAACAACTACGCCTTGG
GGGAGACTTTTTGAGTCGAGAG

(ATG)6

171

1

M

+

+

+

-

+

+

+

+

+

+

+

2

-

EX720157.1

LM-45

GTGATGATGATGGTGGCG
GCTCTTCACACTCCCCAGAG

(TCT)5

209

3

0.54

+

+

+

-

+

+

-

-

+

+

+

3

-

EX720130.1

LM-46

CGGATCCTTATAGCCTGCTG
TCCTGGTGCAACCATTACAG

(AAG)6

162

3

0.43

+

+

-

+

-

-

-

-

-

-

-

1

-

EX720114.1

LM-47

CCGTTCACTTTCTCCTCTGC
GGAGACCGAAATTCCAACAC

(AAG)5

161

1

M

+

+

-

-

-

+

-

+

-

-

+

3

-

EX720099.1

LM-48

GGAGGAATAGCGAGCACAAG
TGGTGGTCTTCTGTCCACAC

(GCA)5

162

2

0.47

+

+

+

+

-

-

+

-

-

+

+

2

-

EX720068.1

LM-49

GATCCCCAATCCGATCTTTC
GCTTATCGGAGTACCTCGGC

(AGG)5

208

2

0.40

+

+

+

+

+

+

+

+

-

+

+

2

-

EX720059.1

LM-50

CATCTTTGCAGTGAAGGTGG
GAAAATTGCAGGCTCTCTCC

(GAT)5

188

2

0.29

-

+

-

+

-

-

+

-

-

-

-

1

-

EX720044.1

LM-51

CGTCTGTTTCACTCCTCAGC
GAGGCACCCATGGTGAAC

(TCT)6

198

2

0.49

+

+

-

+

-

+

-

-

+

-

+

2

-

EX720477.1

LM-53

AGAGGAAAATGGAAGAGGCG
CTGAGAAGAGTTGCCACCAG

(ACG)5

150

2

0.39

+

+

-

+

-

+

+

+

+

-

+

2

-

EX720432.1

LM-53

GCATGAGCTCAACAGTCCAG
CGCAGAACAACCTTTGGG

(CAG)5

203

1

M

+

-

-

-

+

-

-

-

-

-

-

1

-

EX720405.1

LM-54

GGAACCGCAGCTGGACTTAG
AAGTAGGCAAGGGTAATGCG

(AGA)6

189

2

0.50

+

+

-

+

-

+

+

-

+

+

+

2

+

EX720361.1

LM-55

TAGACGAGACCCAGCAGAGC
ATGATGAGTCCGGTGAGGAG

(AGA)5

154

4

0.39

+

+

+

+

+

+

+

+

+

+

+

2

+

EH792583.1

LM-56

AGCTTGTGATGCTGATGGTG
CGAGGGATACTCTAGAGCGG

(TAA)6

161

1

M

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

EH792520.1

LM-58

TCTCCTGCAGCCTCCACTAC
TCCTATCCAACAATCCGTCG

(GCC)5

196

1

M

+

+

-

-

-

+

+

-

+

-

+

1

-

EH792442.1

LM-59

ATTGGATGCTGGATGGAGAC
ATGATCAGTAAAGGCGGCAG

(GCA)6

193

1

M

+

+

+

+

+

+

+

-

+

+

+

2

+

EH792413.1

LM-60

AAGACGCTGCTGAATCATTG
TATCACGCAACTCCAGCTTC

(GAA)5

162

2

0.49

+

+

+

+

+

+

+

-

+

-

+

1

-

EH792342.1

LM-61

TGGGTGAAGAAAAGAAAGAGG
GCAACCTTCCTAGCACAAGC

(AAG)5

178

1

M

-

-

-

+

-

-

-

-

-

-

-

1

-

EH792318.1

LM-62

AACCAGCAGCTTCCAAAGAC
GAGGGGTTAGGAAAGCTACAATC

(AGG)5

155

2

0.39

+

+

+

+

+

+

+

+

+

+

+

3

-

EH792278.1

LM-63

TATTTCATGCACCGCAAAAC
GTCATTTCCCTTCCTCCTCC

(GAG)6

180

1

M

+

+

+

-

+

+

+

+

+

-

+

2

+

EH792257.1

LM-65

TTCACAAGGCCTAACCCATC
AGCACACTTCTCCTTCAGGG

(ATC)5

166

1

M

+

+

+

+

-

+

+

-

+

-

+

2

+

EH792225.1

LM-66

TTATTATTAATTCAACCACAACGC
CGATGAAGCTTGTGATGCTG

(TAT)7

152

1

M

+

+

-

-

-

-

-

-

+

-

-

1

-

EH792154.1

LM-67

ACTGCGAAATCGAGATCAGG
GAGGAGGCAAAGCCAAAGTC

(CCA)6

177

1

M

+

+

-

+

-

+

+

-

+

-

-

2

+

EH792070.1

LM-68

GAATTCCCGGGATATCGAAC
AGCATGGTGGTGCTGGTG

(CAT)4(CAT)5

168

1

M

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

n/e

EH792050.1

LM-69

ATACTTGGCTAGTGGTGGCG
TCTCCAGAACCCTGAACACC

(TGA)5

155

2

0.44

+

+

-

+

-

-

-

+

+

-

-

1

-

EH791974.1

LM-70

AAAGGCAGGCACATCAAGAG
TGGGAAGAGGAAGAGGAGTTG

(GAA)6

205

3

0.41

+

+

+

+

-

+

+

+

+

+

+

3

+

EH791902.1

LM-71

ATGACAATGCTCCTCCATCC
GGCGGTACTTGTGAGCAGG

(CAT)5

168

1

M

+

+

-

+

-

-

-

-

-

-

-

1

-

EH791837.1

LM-72

CTTCCCCTTCTCCTCCTCAG
ACTTGTCACCCACCTCATGC

(GGC)6

168

2

0.30

+

+

-

+

-

+

-

-

+

-

-

1

-

EH791736.1

LM-73

ATACCCTACTGTTGCTGGGC
TTGACTGTCATGGCTAATGGAG

(GAT)5

184

2

0.39

+

+

+

+

-

+

-

-

+

-

+

1

-

EH791609.1

LM-74

CTTACCGTCCCCAGCCATAC
CGGTGAATACGGAGAGAAGG

(TCC)6

193

1

M

+

+

-

+

-

+

+

+

+

+

+

1

-

EH791602.1

LM-75

CCGCCGGAAAAAGAATTTAC
TGAGGAGGTAATGGGTGACG

(CAG)5

161

1

M

+

+

+

+

+

+

+

+

+

+

+

1

-

EH791368.1

LM-76

GATATCGTCGACCCACGC
GCACTCGAAGCACACTTCTC

(ATC)5

150

2

0.40

+

+

+

-

+

+

+

-

+

-

+

2

-

EH791352.1

LM-77

CTTTTGAAGCTATGGCGGAG
CTGCAGACCTCCGACTCTTC

(TTC)8

165

1

M

+

-

-

-

-

-

-

-

-

-

+

3

-

EH791256.1

LM-79

GCAACAGCAGCAGTAAGCAG
TAATTCGCCACCACGCTTAG

(CAT)5

173

2

0.18

+

+

+

+

+

+

-

+

+

+

+

3

+

EH791220.1

LM-80

CCACAACCAAATGGGAAATC
CCCATTTGACAGCAAAACTC

(ATC)6

156

2

0.42

+

+

+

+

+

+

+

+

+

+

+

3

+

EH791187.1

LM-81

TCAACACCTTCAACACCACC
GTCCTTTGGATGGAAGGAGG

(CAG)5(GGA)5

154

1

M

+

+

-

+

-

+

-

-

-

-

-

1

-

CA483361.1

LM-84

CTTCCCAAAGAAGACCCTCC
CTTTTTCAGCTGAGCTTGGG

(GAA)7

174

1

M

-

+

-

+

-

+

-

-

-

-

-

2

-

CA483453.1

LM-85

CACCCCTGCTGGAAACAG
CGATAGCCAATGGATTCGTC

(ACA)5(ATA)6

185

2

0.15

+

+

+

+

-

+

+

-

+

-

+

1

-

CV478207.1

LM-86

ACCTTTCCCAACCATAACCC
AATTCGGGTCAGAAGCAATG

(ATA)6

185

2

0.08

+

+

+

+

+

+

-

-

+

-

-

5

+

CV478210.1

LM-87

GACTATGGCCTTTCAGCACC
AGCTCTCAGAGTTCATCAAACG

(CTT)10

169

2

0.22

+

+

+

+

-

+

+

-

+

-

+

3

+

CV478252.1

LM-88

CCTGATCTCCATAACTTCCCC
GAAAATTGGTGTCGGCGG

(CAA)6

151

1

M

+

+

-

+

-

+

+

-

-

-

+

3

+

CV478306.1

LM-89

GGGAGAGAAGGGATTGGAAG
TCCTGCATACACACCTTCAAC

(TAG)6

156

1

M

+

+

+

+

+

+

+

+

+

+

+

4

+

Tranferability (%) 

92.8
92.8
53.7
78
41.5
75.6
58.5
39
78
34.1
70.7
 

L.b.: Linum bienne; L.p.: Linum pallescens; L.a.: Linum altaicum; L.g.: Linum grandiflorum; L.n.: Linum narbonense; L.l.: Linum lewissi: L.h.: Linum hirsutum; L.t.: Linum tenuifolium; L.s.: Linum strictum; L.ta.: Linum tauricum; L.f.: Linum flavum. M: Monomorphic markers in L. usitatissimum. n/e: not expected size allele in Linum species. * EST-SSR markers which amplify potential multi allele/loci in Linum species. Annealing temperature was set at 60°C.