Biol Res 35: 421-431, 2002

Grape seed extract proanthocyanidins downregulate HIV-
1 entry coreceptors, CCR2b, CCR3 and CCR5 gene
expression by normal peripheral blood mononuclear cells.

MADHAVAN P NAIR*, CHITHAN KANDASWAMI**, SUPRIYA MAHAJAN*
HARIKRISHNA N NAIR*, RAM CHAWDA*, THOMAS SHANAHAN* AND STANLEY A
SCHWARTZ*

*Departments of Medicine and Microbiology, Kaleida Health System, Buffalo General Hospital,
**Department of Clinical Laboratory and Biotechnical Sciences, 26 Cary Hall, State University of New
York at Buffalo, Buffalo, New York 14203, USA

ABSTRACT

Flavonoids and related polyphenols, in addition to their cardioprotective, anti-tumor, anti-inflammatory, anti-carcinogenic and anti-allergic activities, also possess promising anti-HIV effects. Recent studies documented that the ß-chemokine receptors, CCR2b, CCR3 and CCR5, and the a-chemokine receptors, CXCR1, CXCR2 and CXCR4 serve as entry coreceptors for HIV-1. Although flavonoids and polyphenolic compounds elicit anti-HIV effects such as inhibition of HIV-1 expression and virus replication, the molecular mechanisms underlying these effects remain to be clearly elucidated. We hypothesize that flavonoids exert their anti-HIV effects, possibly by interfering at the HIV co-receptor level. We investigated the effect of flavonoid constituents of a proprietary grape seed extract (GSE) on the expression of HIV-1 coentry receptors by immunocompetent mononuclear leukocytes. Our results showed that GSE significantly downregulated the expression of the HIV-1 entry co-receptors, CCR2b , CCR3 and CCR5 in normal PBMC in a dose dependent manner. Further , GSE treated cultures showed significantly lower number of CCR3 positive cells as quantitated by flow cytometry analysis which supports RT-PCR gene expression data.Investigations of the mechanisms underlying the anti-HIV-1 effects of grape seed extracts may help to identify promising natural products useful in the prevention and /or amelioration of HIV-1 infection.

Key terms: PBMC, peripheral blood mononuclear cells; RT- PCR - reverse transcriptase polymerase chain
reaction, HIV-1 , human immunodeficiency virus-1 GSE,- Grape Seed Extract.

INTRODUCTION:

The natural antioxidants, flavonoids, comprise a large group of polyphenolic compounds which occur both in edible plants and plant foodstuffs, and are an integral part of the human diet (7,8, 9, 11, 19, 22, 25, 26, 39). Their distribution is almost ubiquitous in the plant kingdom. More than 4,000 chemically unique flavonoids identified in plants sources, i.e., in fruits, cereals, legumes, vegetables, nuts, seeds, herbs, spices, stems, flowers as well as in beverages such as tea, cocoa, beer and wine, belong to different classes (7,8, 9,11,19,22, 25, 26, 39). The family includes flavanols and proanthocyanidins, flavanones, anthocyanidins, flavones, isoflavones and flavonols (10). Estimates for the average daily Western intake of mixed flavonoids are in the range of 0.5 to 1 g (19, 32), although recent reports estimate the actual intake to be frequently lower, about 200 mg of mixed flavonoids (12). However, such a quantity could provide pharmacologically significant concentrations in body fluids and tissues. The dietary intake of flavonoids far exceeds that of vitamin E, a monophenolic antioxidant, and of beta-carotene ( 12 ).

Plant flavonoids can potentially modulate critical processes which in disease states manifest as allergic reactions, inflammatory disorders, viral infection, tumor development and vascular dysfunction, amongst others . Of the many diverse pharmacologic actions of the dietary flavonods, their antiinflammatory and anti-viral effects stand out. These dietary antioxidants exert significant immunomodulatory activities and critically influence a host of inflammatory processes and immune functions, and modulate cell surface signal transduction (13,14, 26, 27, 28). Food derived flavonoids exhibit significant anti-viral effects by inhibiting reverse trancriptase of various retroviruses (36), including that of HIV (30). Kreis et al. (17) documented that extracts from hyssop leaves containing tannic acids and flavonoids inhibited reverse transcriptase activity, syncytium formation and the expression of P17 and p24 HIV antigen in cells infected with HIV. Recent preliminary investigations (8) also indicate that flavonoids and polyphenolic compounds such as ferulic, gallic, and caffeic acids, ethyl gallate, curcumin and a-tocopheryl-succinyl-O-ethyl ferulate inhibit up to 80% of HIV replication, and prevent cellular glutathione consumption.

Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Compared with certain common dietary sources, grape seeds contain higher levels of flavonoids. The phenol composition of grape seed is essentially all flavonoids, predominantly belonging to the class «flavans and proanthocyanidins». Proanthocyanidins consist of flavonol units (33). Grape seed extract proanthocyanidins consisting of monomers, oligomers and polymers (18), belong to the subclass procyanidins and catechin is the constituent flavanol monomer present in them as shown in Fig 1.

The phenolic profile of the extract, GSE, used in the present study, as determined by HPLC, was about 8% monomers, 70% oligomers and 22% polymers. Operationally, the oligomers are of chain length 2-7 (dimers to heptamers). Polymers represent components of chain length greater than 7 (above heptamers). The extract contains a high degree of oligomers in contrast with some commercially available grape seed extracts that possess a higher percentage of polymers. We believe that a product predominant in oligomers would have significant biologic activity. Recent work with experimental animals and in vitro systems shows the above trend (15, 31 ,37). The concentration of polyphenols in GSE is 35% higher than that of Pycnogenol (39,41). The quality of phenol in terms of its antioxidant properties was 3 times higher than vitamin C, 5 times better than vitamin E and 1.6 times better than grapes and 1.5 times better than grape juices (39,41).

Although the CD4 molecule is the major cellular receptor for HIV, recent studies convincingly suggest that efficient viral entry requires other co-receptors (1). In patients with active HIV infection, the virus uses an expanded range of co-receptors, including chemokine receptors such as CCR2b, CCR3, CCR5 and CXCR4, and there is an association of this adaptation with the progression to AIDS. A recent study shows the expression of CCR3 on Th-2 cells (35), and CCR3 appears to be a prerequisite for the infection of the central nervous system (25). Others have recently detected CCR5, CCR3 and CCR2b in brain endothelial cells (2) the existence of which may facilitate HIV entry through blood brain barrier.

Although several flavonoids exhibit significant antiñHIV effects (37), the molecular mechanisms underlying this activity remain to be elucidated. Recent studies (1) demonstrated that the chemokine receptors, CCR2b, CCR3 and CCR5 served as entry coreceptors for HIV-1 into susceptible target cells. Since flavonoids display intriguing anti HIV effects, it is conceivable that among other known anti-HIV effects, flavonoids also downregulate the HIV-1 coreceptor gene expression, thus inhibiting the binding of the virus to the receptor and consequently preventing its entry into susceptible cells. In as much as flavonoids are important natural products, their effects on recently discovered HIV-1 entry coreceptors warrant examination.

MATERIALES AND METHODS

Isolation of PBMC and Cell culture
Techniques:

Peripheral blood mononuclear cells (PBMC) (3 X 10⁶ cells /mL) were cultured in RPMI 1640 medium containing 10% Fetal bovine serum (FBS) (Gibco- Life Technologies), 300ug/mL of fresh glutamine and 80ug/ul of gentamicin (complete medium) alone or with a proprietary GSE (Vinox^®, Polyphenolics, Canandaigua Brands, Inc, Madera, CA) at concentrations ranging between 0.05 to 5 mg/mL for 24 hrs at 37ºC. The cultured cells were used for flow cytometry analysis as well as for RNA.

RNA extraction:

Cytoplasmic RNA was extracted by an acid guanidinium thiocyanate - phenol / chloroform method as described by Chomczynski & Sacchi (5). Cultured cells were pelleted by centrifugation and resuspended in a 4M solution of guanidinium thiocynate. Cells were agitated by repeated pipetting so as to lyse them and then phenol-chloroform extracted in the presence of sodium acetate. After centrifugation, the RNA was precipitated from the aqeous layer by adding an equal volume of isopropanol and the mixture was kept at -20ºC for 1 h and then centrifuged to pellet the RNA. The RNA pellet was washed with 75% ethanol to remove any remaining traces of guanidium salt. The final pellet was dried and resuspended in DEPC water, and the amount of RNA determined using a spectrophotometer at 260 nm. Isolated RNA was kept at -70C until used.

RT-PCR Techniques

The RT-PCR reactions were performed using a Perkin Elmer kit (Cat # N808-0143). The RNA was reverse transcribed to make a DNA copy for use in PCR. Briefly 1 µg of RNA was added to a tube containing 5 mM MgCl₂, 1mM each of dNTP ( ATGC), 50 mM KCL, 10 MM Tris Buffer pH 8.3 , 2.5 uM oligodT , 20 units of Rnase -inhibitor and 50 units of MuLV reverse transcriptase.The mixture was incubated at 45ºC for 35 mins and then heated to 95o C for 5 min and placed on ice until used for PCR. This newly synthesized cDNA was then amplified by PCR using specific sense and antisense primers of the genes of interest along with an housekeeping gene, G3PDH or ß-actin as a controls . Briefly to each tube, a 10 µl sample of the RT product in a final concentration of 2mM MgCl₂, 10 mM Tris pH 8.3, 50 mM KCl , plus 0.02 uM of both the 5' and 3' primers and 2.5 units of Taq polymerase was added. The mixture was then placed in a thermocycler for 30 cycles of 95oCfor 30 secs, 60ºC for 30 secs and 74ºC for 1 min. Samples were then separated on a 1-1.2% agarose gel along with a molecular weight marker for reference , and bands were visualized , fragment size determined and quantitated using a scanning densitometer. All values were normalized to the constitutive expression of the housekeeping gene.

FACS Analysis:

Immunofluorescent staining was used to identify and quantitate the number of cells that express CCR3 surface antigen. Approximately 1x10⁶ lymphocytes were treated with GSE ( 0.5,0.05 and 0.005 mg/mL) for 24 hrs. Cells were harvested, washed and suspended in staining buffer. FACS Calibur conditions were optimised on adjusting the settings for PMT voltage and compensation using appropriate controls, and quadrant markers were set using specified isotype control for flurochrome -conjugated specific antibody. The mAbs against CCR3 were conjugated to phycoerythrin (PE) and were obtained from BD Pharmingen. Cells were fixed by resuspending in 100 ul of Cytofix/Cytoperm buffer for 10-20 mins at 41C and permeabilised in 1X Perm solution and then resuspended in staining buffer prior to flow cytometric analysis. Stained cells were subjected to a light scatter analysis and a fixed population of cells were gated. Cells positive for CCR3, were expressed as percentage of the total cells gated and are represented on the FL-2 axis in Figure 5.

RESULTS

Effect of GSE on viability of the PBMC

Cultures of PBMC (3x10⁶/mL) received either media alone or different concentrations of the grape seed extract, GSE, (0.05 to 5 mg/mL). After 24 hr of incubation, the cells were tested for viability by trypane blue dye exclusion assay. GSE treated cells showed levels of viability comparable to those in untreated control culture. We also tested the cell viability after 24 hrs of incubation with GSE by the Cell Titer 96 Aqueous One solution cell proliferation Assay (PROMEGA Cat # G5421). The percentages of viable cells at 5, 1, 0.5, 0.1 and 0.05mg/mL of GSE concentration were 93, 95, 96, 95 and 94 compared to 100 % viable cells present in the control cultures as measured by the Formosan absorbency.(Data not shown)

GSE downregulates HIV co-receptor
CCR2b in normal PBMC:

Data presented in Fig. 2, show the effect of flavonoid, GSE on CCR2b gene expression in PBMC treated culture. House keeping G3PDH and specific target CCR2b amplified products migrated to the expected region of 983 and 950 bp respectively. GSE treated cultures (Fig. 2a, Lanes 2-6) did not affect the house keeping G3PDH specific RNA gene expression which was comparable to that of the control culture (Lane 1). Cultures treated with GSE at 5mg (Fig. 2b, Lane 2; OD=0.278) 1mg (Lane 3; OD=0.376), 0.5mg (Lane 4; OD=0.624) and 0.1mg (Lane 5; OD=1.050) significantly downregulated CCR2b RNA gene expression compared to that of the control culture (Lane 1; OD= 1.298) in a dose dependent manner. Data presented in Fig. 2c shows the mean percent change of OD values from 4 separate experiments. The densitometer readings of CCR2b bands normalized to the G3PDH values were expressed as percent changes in optical density. Cultures treated with GSE exhibited significant downregulation of CCR2b message compared to that of the control cultures. The percent inhibitions are 78.5(p<0.0001), 71(p<0.0001), 51.9 (p<0.001), and 19.9 (p<0.05), respectively for 5, 1, 0.5, and 0.1 mg/mL of GSE concentrations compared to control cultures. GSE at 0.05 mg/ml concentration did not show any modulation of CCR2b gene expression compared to control cultures.

GSE down regulates HIV co-receptor CCR3
in normal PBMC

Data presented in Fig. 3, depict the effect of GSE on CCR3 gene expression in PBMC treated culture. House keeping G3-PDH and specific target CCR3 amplified products migrated to the expected region of 983 and 313 bp, respectively. GSE treated cultures (Fig. 3a, Lanes 2-6) did not affect the house keeping G3-PDH specific RNA gene expression and was comparable to that of the control culture (Lane 1). Cultures treated with GSE at 5mg (Fig. 3b, Lane 2; OD=0.154) 1mg (Lane 3; OD=0.259), 0.5mg (Lane 4; OD=0.352)n significantly downregulated CCR3 RNA gene expression compared to that in the control culture (Lane 1; OD= 0.457) in a dose dependent manner. GSE at 0.1 mg (Lane 5: OD= 0.520) did not modulate CCR3 gene expression compared to control cultures. Data presented in Fig. 3c shows the mean percent change of OD values from 4 separate experiments. The densitometry readings of CCR3 bands normalized to the G3-PDH values were expressed as percent changes in optical density. Cultures treated with GSE at 5,1,0.5 mg/ml demonstrated significant down regulation of CCR3 message compared to that of the control cultures. The percent inhibitions are 65.9(p<0.001), 42.6 (p<0.001), 22 (p<0.05), respectively for 5, 1 and 0.5 mg/ml concentrations compared to control cultures. GSE at 0.1 mg/mL concentration did not show any significant change in CCR3 gene expression and the OD values were comparable to control cultures.

GSE downregulates HIV co-receptor CCR5
in normal PBMC

Data presented in Fig. 4, shows the effect of Flavonoid GSE on CCR5 gene expression in PBMC treated culture. House keeping G3-PDH and specific target CCR5 amplified products migrated to the expected region of 983 and 1117 bp, respectively. GSE treated cultures (Fig. 4a, Lanes 2-6) did not affect the house keeping G3-PDH specific RNA gene expression and was comparable to that of the control culture (Lane 1). Cultures treated with GSE at 5mg (Fig. 4b, Lane 2; OD=0.504) 1mg (Lane 3; OD=0.621), 0.5mg (Lane 4; OD=0.814) and 0.1 mg (Lane 5;OD=1.024) significantly downregulated CCR5 RNA gene expression compared to that of the control culture (Lane 1; OD= 1.300) in a dose dependent manner. GSE at 0.05 mg (Lane 6: OD= 1.436) did not significantly modulate CCR5 gene expression and was comparable to control cultures. Data presented in Fig. 4c shows the mean percent change of OD values from 4 separate experiments. The densitometry readings of CCR5 bands normalized to the G3-PDH values were expressed as percent changes in optical density. Cultures treated with GSE at 5,1,0.5 and 0.1 mg/ml demonstrated significant down regulation of CCR5 gene expression compared to that of the control cultures. The percent inhibitions are 60.2(p<0.001), 50.9 (p<0.001), 35.7(p<0.05) and 19 ( p<0.05), respectively for 5, 1 0.5 and 0.1 mg/ml of GSE concentrations compared to control cultures. GSE at 0.05 mg/mL concentration did not show any significant change in CCR5 gene expression and the OD values were comparable to control cultures.

GSE modulates CCR3 positive phenotypes:

Data represented in Fig. 5 show the effect of GSE on expression of CCR3 antigen as demonstrated by flow cytometry. Cells treated with GSE (0.5,0.05 and 0.005mg/mL) demonstrated a decrease in the percentage of CCR3 positive cells (Fig 5 b-d) in a dose dependent manner. GSE at 0.5 mg/mL concentration showed significant decrease in CCR3 positive cells (5.5%) compared to that in the control culture (12.4%). Fig. 5e depicts the mean percent + SD of CCR3 positive cells for 3 separate experiments. GSE at 0.5mg/mL showed statistically significant ( p<0.05) decrease in the number of CCR3 positive cells compared to control culture. GSE at lower concentrations of 0.05 and 0.005 mg/mL also decreased the number of CCR3 positive cells, compared to control culture, although these values were not stastistically significant when compared to control cultures.These results demonstrate that GSE treatment results in a decrease in the number of CCR3 positive cells in a dose dependent manner, which corroborates our gene expression data as analyzed by RT-PCR (Fig 3) .

Fig 2.Cultures of PBMC (3x10⁶/mL) received either media alone or different concentrations of the grape seed extract, GSE, (0.05 to 5 mg/mL).Cytoplasmic RNA was extracted from these cultured cells and subjected to reverse transcription. The newly synthetized cDNA products were mixed with the housekeeping gene, G3PDH (5í-TGAAGGTCGGAGTCAACGACGGATTTGGT-3í(upstream),5'-CATGTGG GCCATGAGGTCCACCAC -3' (downstream) (983bp) and CCR2b (5'- GCAGTGAGAGTCATCTTCAC-3' (upstream) 5'AAGAGAATCATCGGACTCCACC -3í-(downstream) (950bp) specific primers in a PCR assay using 30 cycles. The PCR products were separated by 1.2% agarose gel electrophoresis containing ethidium bromide with standard molecular weight markers to determine the fragment size. cDNA from amplified PCR products of G3PDH (Fig. 2a ) and CCR2b (Fig. 2b) banded at 983 bp and 950bp respectively. Fig. 2c. Quantitation of changes in CCR2b gene expression. Percent change in laser densitometry reading of the photogarphic negatives of experimental values after normalization with respective G3PDH values was determined and then compared with control values. These data represent mean percent + SD of results from 4 experiment. Statistical evaluations using Analysis of Variance (ANOVA) showed significant differences between the GSE concentrations compared to the control culture.

Fig 3: Cultures of PBMC (3x10⁶/mL) received either media alone or different concentrations of the grape seed extract, GSE, (0.05 to 5 mg/mL). Cytoplasmic RNA was extracted from these cultured cells and subjected to reverse transcription. The newly synthetized cDNA products were mixed with the housekeeping gene, G3-PDH;(5í-TGAAGGTCGGAGTCAACGACGGATTTGGT-3'(upstream),5'-CATGTGCCATGAGGTCCACCAC-3' (downstream) (983bp) and CCR 3 (5'-TCCTTCTCTCTTCCTATCAATC-3'(upstream) 5'GGCAATTTTCTGCATCTG-3'- (downstream) (313bp) specific primers in a PCR assay using 30 cycles. The PCR products were separated by 1.2% agarose gel electrophoresis containing ethidium bromide with standard molecular weight markers to determine the fragment size. cDNA from amplified PCR products of G3-PDH (Fig. 3a ) and CCR-3(Fig. 3b) banded at 983bp and 313bp, respectively. Fig. 3c. Quantitation of changes in CCR-3 gene expression . Percent change in laser densitometry reading of the photogarphic negatives of experimental values after normalization with respective G3PDH values was determined and then compared with control values. These data represent mean percent + SD from 4 experiment. Statistical evaluations using Analysis of Variance (ANOVA) showed significant differences between the GSE concentrations compared to the control.culture.

Fig 4: Cultures of PBMC (3x10⁶/mL) received either media alone or different concentrations of the grape seed extract, GSE, (0.05 to 5 mg/mL). Cytoplasmic RNA was extracted from these cultured cells and subjected to reverse transcription. The newly synthetized cDNA products were mixed with the housekeeping gene, G3-PDH;(5'-TGAAGGTCGGAGTCAACGACGGATTTGG 3'(upstream),5'-CATGTGGGCCATGAGGTC CACCAC-3' (downstream) (983bp) and CCR 5- (5'CTCGGATCCGGTGGAACAAGATGGATTAT-3'(upstream) 5'CTCGTCGACATGTGCACAACTCTGACTG-3'- (downstream) (1117bp) specific primers in a PCR assay using 30 cycles. The PCR products were separated by 1.2% agarose gel electrophoresis containing ethidium bromide with standard molecular weight markers to determine the fragment size. cDNA from amplified PCR products of G3-PDH (Fig. 4a ) and CCR-3(Fig. 4b) banded at 983bp and 1117bp, respectively. Fig. 4c. Quantitation of changes in CCR-3 gene expression . Percent change in laser densitometry reading of the photogarphic negatives of experimental values after normalization with respective G3PDH values was determined and then compared with control values. These data represent mean percent + SD from 4 experiment. Statistical evaluations using Analysis of Variance (ANOVA) showed significant differences between the GSE concentrations compared to the control.culture.

Fig 5 Flow cytometry analysis of PBMC treated with GSE against phycoerythrin conjugated (PE) CCR3 specific monoclonal antibody. Isotype control monoclonal antibody ( IgG₁ k) was used as a negative control to set quadrant as described by the manufacturer ( data not shown). Fig 5a shows the % of CCR3 positive cells in untreated control ( 12.46%) while Fig 5b shows a significant decrease (5.5% p<0.05) in the % of CCR3 positive cells in cultures treated with 0.5 ug/mL of GSE. Figures 5c & 5d show the % of CCR3 positive cells in 0.05(8.29%) and 0.005 mg/mL (9.54%) of GSE treated cultures respectively. Fig 5e shows the mean percent +SD of % positive cells for 3 separate experiments. GSE significantly suppresses CCR3 positive cells.

DISCUSSION

A score of experimental studies suggest a beneficial effect for flavonoids in human health, owing to their antiinflammatory and antioxidant properties, and their ability to modulate immune processes and the activity of various enzymes (13 ,26, 27 ). Flavonoids can mediate potential beneficial effects by intricately influencing cell surface receptors. GSE flavonoids display intriguing pharmacologic actions and are promising prophylactic agents (15). To glean insight into the mechanism of their action, we have evaluated the capacity of GSE flavonoids to regulate the expression of HIV-1 entry coreceptors by immunocompetent mononuclear leukocytes. Our findings indicate for the first time, as far as we are aware, that GSE flavonoid components can intercept processes culminating in the expression of HIV-1 entry coreceptors. Not much information is available concerning the plasma concentrations of flavonoids following the consumption of products such as GSE. In the present study we observe a positive effect even at a low concentration of 50 µg/mL of the seed extract (about 10-20 µg/mL phenol concentration). Recent work, however, prompts us to infer significant bioavailability of phenolics after consumption of a dealcolized polyphenol extract from red wine, rich in oligomeric procyanidins, by human subjects (3, 25).

Manifestation of appreciable pharmacological activity after consumption of 600mg of GSE by human subjects indirectly indicated substantial absorption (40,41). On the basis of above studies, microgram (or above) concentrations of polyphenols can be expected in vivo. However, no epidemiologic data are available to associate GSE intake with resistance to either HIV disease or infection of lymphocytes from subjects who consume GSE. Our results document that GSE , at concentrations similar to expected in vivo concentrations significantly impairs CCR2b, CCR3and CCR5 gene expression in PBMC in a dose dependent manner. Further, GSE significantly reduced the number of CCR3 positive cells as quantitated by flow cytometry analysis. The inhibitory effect of GSE on CCR2b CCR3 and CCR5 gene expression cannot be merely attributed to its possible toxicity on PBMC, because GSE up to 5 mg/mL showed viability similar to that of control cultures. Thus modulation of the HIV-1 entry co- receptor gene expression by GSE flavonoids appears to be a specific effect. In confirmation to these observations , in separate studies, we have also observed that GSE selectively induces the production of Th-1 derived cytokine, IFNgg by PBMC from normal donors (29). Further studies need to be carried out to rule out any deleterious biologic effects, if any, of a marked reduction in GSE induced CCR2b, CCR3 and CCR5 gene expression by PBMC.

Additional studies are also necessary to examine the effects of GSE on HIV coreceptor gene expression in cells obtained from HIV infected subjects, or its effect on HIV-1 entry into normal healthy lymphocytes. Several studies propose that the pharmacologic effects displayed by procyanidin mixtures are due to the oligomers present therein (4, 6 , 15, 38, 24). Laparra et al. (21) showed the rapid appearance of relatively small but significant radioactivity in the blood of rats after oral administration of a grape preparation containing radioactive carbon-labeled procyanidin dimers. Assuming that the preparation was free of monomers, and that no degradation of the dimers occurred in the acid conditions prevailing in the stomach, this reflects facile absorption of the intact dimers. Harmund and Blanquet (10) documented similar results on the absorption of radioactive grape procyanidin oligomers and reported that the amount of radioactivity excreted into the feces increased with the dose. Yamakoshi et al. (43) reported the detection of procyanidins in the plasma of grape seed extract-fed rabbits, 1 hr after administration of the extracts, by colorimetric determination of the anthocyanidin released from the acetone extracts of plasma by acid treatment. In a subsequent study (15), these authors reported a rapid appearance of procyanidins in the plasma of grape seed extract-fed rats and contended that the compounds present in the plasma represented shorter oligomers. One might expect that procyanidin oligomers conforming to certain size range would attach to proteins in as much as binding to proteins and carbohydrates is one of the intrinsic characteristics of long chain procyanidins. While examining the effect of feeding of grape seed extracts, predominantly containing longer procyanidins, to rats, Saito et al. (35) reported that procyanidins covered the surface of the stomach when the stomach was incised, possibly due to their binding to proteins.

Recent studies showed that human subjects who consumed red wine excreted intact procyanidins (36,39). In this context, it is interesting to note that procyanidins and anthocyanidins are the major polyphenol constitutents of red wine and red grapes. Lapidot et al. (20) reported the bioavailability of red wine anthocyanins as detected in the urine of volunteers, a surprising finding. Anthocyanidins are stable only at very low pH. The authors deduced that proanthocyanidins entering the body from the administered red wine in this instance would have degraded to anthocyanidins in the urine (under its acidic conditions), upon storage.

Conventional antiretroviral drugs such as AZT, ddI and ddC and recently discovered HAART regimens containing protease inhibitors can have serious side effects (40). Only a few natural products from plants have received scrutiny for their potential anti -HIV effects (17, 22).

Discovery of very specific and less toxic antiviral agents is a current high priority in the search for more effective therapies against HIV(21). Our results show that flavonoid constituents found in the grape seed extract, GSE, significantly downregulated the expression of the HIV-1 entry co-receptor, CCR2b CCR3 and CCR5 by normal PBMC in a dose dependent manner. This suggests that flavonoid components of the extract can interfere with the binding of the virus to the cell receptor and, thus can prevent HIV entry into the normal lymphocyte .

Evaluation of the mechanism of the anti-HIV effects of flavonoids may lead to the identification of new anti-HIV agents useful in the treatment of patients with AIDS. Furthermore, these studies may provide new information and impetus for developing a potential clinical trial of grape proanthocyanidins as an adjunct nutritional supplement, along with the existing conventional therapeutic regimens, in the treatment of HIV infection. Investigation of mechanisms underlying the anti- HIV-1 effects of grape seed extracts may help identify promising natural products useful in prevention and /or amelioration of HIV-1 infection.

ACKNOWLEDGMENTS

This study was supported by NIH grants R03 NIDA 1119-01, R01 MH 47225, R01 DA 10632, R01 DA 12366, R01-DA 15628 and the Margaret Duffy and Robert Cameron Troup Memorial Fund of the Buffalo General Hospital, Kaleida Health System.We wish to thank Mr. Richard Keeley for the provision of grape seed extracts, and for his support and encouragement.

REFERENCES

1) ALKHATIB G, COMBADIERE C, BRODER CC, FENG Y, KENNEDY, PE, MURPHY PM, BERGERT, EA (1996) CC CKR5: a RANTES, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1 Science 1996:272(5270): 1955-1958

2) BERGER O, GANX, GUJULUVA C, BURNS AR, SULUR G, STINS, MWAY D, WITTE M, WEINAND M, SAID J, KIM KS, TAUB D, GRAVES MC, FIALA M (1998) CXC and CC chemokines receptors on coronary and brain endothelia Mol Med 5 (12) 795-805

3) CARBONNEAU MA, LEGER CL, MONNIER L, BONNET C, MICHEL F, FOURET G, DEDIEU F, DESCOMPS B (1997) Supplementation with wine phenolic compounds increases the antioxidant capacity of plasma and vitamin E of low-density lipoprotein without changing the lipoprotein Cu (2+)-oxidizability: possible explanation by phenolic location Eur J Clin Nutr 51:682-90

4) CHATTERJEE SS, KOCH E, JAGGY H, KRZEMINSKI T (1994) In vitro and in vivo studies on the cardioprotective actin of oligomeric procyanidins in a cvataegus extract of leaves and blooms Arzneimittel-Forforsch: 47(7):821-825

5) CHOMCZYNSKI P, SAACHI N (1987) Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal Biochem 162:156

6) CISHEK MB, GALLOWAY MT, KARIM M, GERMAN B, KAPPAGODA CT (1997) Effect of red wine on endothelium-dependent relaxation in rabbits Clinical Science Clin Sci93, 507511

7) CROZIER A, BURNS J, AZIZ AA, STEWERT AJ, RABIASZ HS, JENKINS GI, EDWARDS CA, LEAN ME (2000) Antioxidant Flavonols from fruits, vegetables and beverages: Measurements and bioavailabilty Biol Resl 33(2)79-88

8) EDEAS MA, LINDENBAUM A (1999) Bio-flavonoids and polyphenols in health and disease SFRR Europe Winter Meeting, OP 27, abstract

9) HARBONE JB (1988) The Flavonoids : advances in research since 1980 In: London: Chapman and Hall, (pp 1-621) (ed) Harbone JB

10) HARMAND MF, BLANQUET P (1978) The fate of total flavanolic oligomers (OFT) extracted from Vitis vinifera L in the rat Eur J Drug Metab Pharmacokin 1:15- 30

11) HERMANN K (1976) Flavonols and Flavones in food plants: A review J Food Technol 11: 433-438

12) HERTOG MGL, HOLLMAN PCH, KATAN MB, KROMHOUT D (1993)Intake of potentially anticarcinogenic flavonoids and their determinants in adults in the Netherlands Nutr Cancer 20(1): 21-29

13) HUANG YT, HWANG JJ, LEE PP, KE FC, HUANG JH, HUANG CJ, KANDASWAMI C, MIDDLETON E JR, LEE MT (1999) Effects of luteolin and quercetin, inhibitors of tyrosine kinase, on cell growth and metastasis-associated properties in A431 cells overexpressing epidermal growth factor receptor Br J Pharmacol128: 999- 1010

14) KANDASWAMI C, MIDDLETON E JR (1994) Free radical scavenging and antioxidant activity of plant flavonoids Adv Exp Med Biol 366: 351-376

15) KAPPAGODA CT, KARIM M, MCCORMICK K, KANDASWAMI C (2000) Unraveling the French Paradox Chem Innov 30: 26-31

16) KOGA T, MORO K, NAKAMORI K, YAMAKOSHI J, HOSOYAMA H, KATAOKA S, ARIGA T (1999) Increase of antioxidative potential of rat plasma by oral administration of proanthocyanidin - rich extract from grape seed J Agric Food Chem 47 : 1892-1897

17) KREIS W, KAPLAN MH, FREEMAN J, SUN DK, SARIN PS (1990) Inibition of HIV replication by hyssop officinalis extracts Antiviral Res 14(6): 323-337

18) KRUEGER CC, DOPKE NC , TREICHEL P M, FOLTS J, REED JD (2000) Matrix -assisted laser desorption/ ionization time -of- flight mass spectrometry of polygalloyl polyflavan -3- ols in grape seed extract J Agric Food Chem 48(5): 1663-7

19) KUHANU J (1976) The flavonoids: a class of semi-essential food components: their role in human nutrition World Rev Nutr Diet 24, 117-120

20) LAPIDOT T, HAREL S, GRANIT R, KANNER J (1998) pH Dependent forms of red wine anthocyanins as antioxidants J Agric Food Chem 46:4297-4302

21) LAPPARA J, MICHAUD J, MASQUALIER J ( 1977) Pharmacokinetic study of Flavanolic oligomers J Plant Med Phytother: 11; 133-142

22) LEIGHTON F, CUEVAS A, GUASCH V, PEREZ DD, STROBEL P, SAN MARTIN A, URZUA U, DIEZ MS, FONCEA R, CASTILLO O, MIZON C, ESPINOZA MA, URQUIAGA I, ROZOWSKI J, MAIZ A, GERMAIN A (1999) Plasma polyphenols and antioxidants, oxidative DNA damage and endothelial function in a diet and wine intervention study in humans Drugs Exp Clin Res 25:133-141

23) LI BQ, FU T, DONGYAN Y, MIKOVITS JA, RUSCETTI FW, WANG JM (2000) Flavonoid baicalin inhibits HIV-1 infection at the level of viral entry Biochem Biophys Res Commun 276(2) : 534-8

24) MEUNIER MT, VILLIE F, JONADET M, BASTIDE J, BASTIDE P (1987) Inhibition of angiotensin I converting enzyme by flavanolic compounds: In vitro and in vivo studies Planta Med 53 (1): 12-15

25) MICHAEL, NL Protective effect of an SDF-1 variant in HIV disease: abstract KRUEGER CC, DOPKE NC, TREICHEL P M, FOLTS J, REED JD (2000) Matrix -assisted laser desorption/ ionization time -of- flight mass spectrometry of polygalloyl polyflavan -3- ols in grape seed extract J Agric Food Chem 48(5): 1663-7

26) MIDDLETON E JR, KANDASWAMI C, (1994) In: THE FLAVONOIDS: ADVANCES IN RESEARCH SINCE 1986 JB HARBORNE, (ed), p 619-652, Chapman and Hall, London

27) MIDDLETON, E, JR, KANDASWAMI, C AND THEOHARIDIS TC (2000) The effects of plant flavonoids on mammalian cells: implications for inflammation, heart disease and cancer Pharmacol Rev 2000: 52(4):673-751

28) MIDDLETON E JR, KANDASWAMI C (1992) Effecst of flavonoids on immune and inflammatory cell functions Biochem Pharmacol 46 (6): 1157-1179

29) NAIR N, MAHAJAN SD, CHAWDA R, SHANAHAN T, SCHWARTZ SA ( 2002) Grape Seed extract activates Th-1 cells In vitro Clin Diagn Lab Immunol Mar: 9(2):470-476

30) NIGDIKAR SV, WILLIAMS NR, GRIFFIN BA, HOWARD A N (1998) Consumption of red wine polyphenols reduces the susceptibility of low-density lipoproteins to oxidation in vivo Am J Clin Nutr 68(2): 258-265

31) ONO K, NAKANE H (1990) Mechanisms of inhibition of various cellular DNA and RNA polymerases by several flavonoids J Biochem(Tokyo) 108 (4) : 609-613

32) PALMA M, TAYLOR LT, VARELA RM, CUTLER SJ, CUTLER HG (1999) Fractional extraction of compounds from grape seeds by supercritical fluid extraction and analysis for antimicrobial and agrochemical activities J Agric Food Chem 1999: 47(12):5044-5048

33) PIERPOINT WS (1986) Flavonoids in the human diet Prog In Clin Biol Res 213 125-140

34) PALGAN K, DREWA G (1994) Flavonoids in medicine. Postepy Hig Med Dosw . 48 (5):589-601

35) SAITO M, HOSOYAMA H, ARIGA T, KATAOKA S, YAMAJI N (1998) Dose response effect of dietary docosahexaenoic acidon fatty acid profiles of serum and tissue lipids in rats J Agric Food Chem 46(1): 1460-1464

36) SALLUSTO F, LENIG D, MACKAY CR, LANZAVECCHIA A (1998) Flexible programs of chemokine receptor expression on human polarized T helper 1 and 2 lymphocytes J Exp Med 187(6):875-883

37) SPEDDING G, RATTY A, MIDDLETON JR E (1989) Inhibition of reverse transcriptase by flavonoids Antiviral Res 12 (2): 99-110

38) TEBIB K, BESANCON P, ROUANET JM (1994) Effect of grape seed tannins on the activity of some rat intestinal enzyme activities J Nutr 124: 2451-2457

39) URQUIAGA I, F LEIGHTON F (2000) Plant Polyphenol Antioxidants and Oxidative Stress Biol Res 33 ( 2)55-64

40) VIGOUROUX C, GHARAKHANIAN S, SALHI Y, NGUYEN TH, ADDA N, ROZENBAUM W, CAPEAU J (1999) Adverse metabolic disorders during highly active antiretroviral treatments (HAART) of HIV disease Diabetes Metab 25(3): 383-392

41) VINSON JA, PROCH J (1999) Antioxidant and Clinical studies with a grape seed extract. (In: Polyphenols, Wine and Health Communications, Groupe Polyphenols International Symposium, Bordeaux (France), April 14-16, 1999, Group Polyphenols and the Phytochemical Society of Europe. 65-66

42) VINSON JA (1998) Flavonoids in foods as in vitro and in vivo antioxidants Adv Exp Med Biol 439 : 151-64

43) YAMAKOSHI J, KATAOKA S, KOGA T, ARIGA T (1999) Proanthocyanidin -rich extract from grape seeds attenuates the development of aortic antherosclerosis in cholesterol fed rabbitsJ Atherosclerosis 142 1999: 139-149

Corresponding Author : Madhavan P.N. Nair Ph.D. Research Professor, Dept of Medicine & Microbiology, Div of Allergy, Immunology and Rheumatology. 310 Multi Research Bldg, Buffalo General Hospital, 100 High Street, Buffalo, NY 14203. Email: mnair@acsu.buffalo.edu. Tel : 716 859 2985. Fax: 716 859 2999

Received: July 23, 2002. In revised form: September 19, 2002. Accepted: September 30, 2002