SciELO - Scientific Electronic Library Online

 
vol.126 número7Características clínicas y de laboratorio de pacientes con reflujo gastroesofágico crónico patológicoPlásmido de virulencia en Yersinia enterocolitica O:3 de origen murino índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Revista médica de Chile

versión impresa ISSN 0034-9887

Rev. méd. Chile v.126 n.7 Santiago jul. 1998

http://dx.doi.org/10.4067/S0034-98871998000700005 

La variación genética de MSX1
presenta un dimorfismo sexual en la
fisura labiopalatina no sindrómica
en la población chilena
 
Rafael Blanco C, Lilian Jara S, Cecilia Villaseca G,
Hernán Palomino Z, Hernán Carreño Z
 

Genetic variation of MSX1 has a
sexual dimorphism in non syndromic
cleft palate in the Chilean population

 

Background: Recent studies in mice have demonstrated that the Msx-1 homebox gene is implicated in cleft palate. Thus, it has been suggested that its human homologue, MSX1 (HOX-7), located in chromosome 4 could be involved in the etiology of non syndromic cleft lip palate. Aim: To study the linkage between non syndromic cleft palate and variations of MSX1 gene. Patients and methods: Seventy three patients with non syndromic cleft lip palate (34 simplex and 37 multiplex), 127 unaffected relatives of the cases (61 relatives of simplex cases and 66 relatives of multiplex cases) and 77 controls were studied. DNA was extracted from leukocytes and the intragenic microsatellite sequence was amplified by PCR. Results: A polymorphism of four alleles was observed, 1 (175 bp), 2 (173 bp), 3 (171 bp) and 4 (169 bp). Alleles 2 and 4 showed a joint variation in males with multiplex cleft lip palate and in their respective unaffected male relatives, that was significant when compared with male controls. Instead, the joint variation of alleles 1 and 4 of unaffected female relatives had significant differences with female controls. Females with multiplex cleft lip palate differed from female controls only in allele 1. Conclusions: These results support the hypothesis of a genetic heterogeneity in the etiology of non syndromic cleft lip palate.
(Key-words: Gene expression; Genetics, medical; Cleft lip; Cleft palate)

 

Desde la publicación del trabajo de Ardinger y cols 1 en 1989, en el que estos autores comunican haber detectado una asociación significativa de dos fragmentos de restricción polimórficos en el largo (Restriction Fragment Length Polymorphism) (RFLP) del locus Factor Transformante de Crecimiento Alfa (TGFA) (Transforming Growth Factor Alpha) y fisura labiopalatina no sindrómica (FLPNS), numerosos trabajos han aparecido en la literatura intentando defnir el rol de este locus, así como de otros loci candidatos, situados en distintos cromosomas, en la etiología genética de esta malformación 2,24.
Estos análisis se han efectuado por medio de estudios de asociación o de ligamiento, los cuales a la fecha, muestran resultados aparentemente inconsistentes y contradictorios lo cual parece reflejar tanto la complejidad etiológica involucrada así como heterogeneidad genética.
Un aspecto adicional que contribuye a hacer más difícil la interpretación de los resultados, es que los estudios de ligamiento se efectúan en familias que muestran agregación familiar, es decir, en aquellas con más de dos individuos afectados y que corresponden a lo que se denominan familias multiplex. Además, ha sido en este tipo de familias multiplex en las que se han efectuado análisis de segregación compleja cuyos resultados han postulado que el modelo de herencia que mejor se ajusta a estos datos es el de gen mayor. No obstante, recientes estudios sugieren que la agregación familiar de la fisura labiopalatina no sindrómica puede ser atribuida a los efectos de varios loci de susceptibilidad que interactuarían entre sí, modelo denominado oligogénico y que fuera propuesto por Mitchell y Risch 25 , 1992 y Farral y Holder 26 en 1992. Como también se observan familias con un solo individuo afectado (familias simplex) el no incluirlas, conjuntamente en dichos análisis, supone implícitamente que se trataría de grupos etiológicamente diferentes e indirectamente apoyaría la hipótesis de heterogeneidad genética para esta patología. Los estudios de asociación a diferencia de los de ligamiento incluyen generalmente en sus análisis a ambos tipos de familias, aunque pocos realizan análisis separados para cada grupo.
En el cromosoma 4 se han estudiado varios loci candidatos, ya sea como loci de susceptibilidad de FLPNS propiamente tales o como loci ligados a un locus de fisura. Entre ellos se incluye el locus del factor de crecimiento epidermal (EGF) (Epidermal Growth Factor) (4q25.27), cuyo análisis de asociación efectuado por Ardinger y cols 1, 1989 arrojó resultados negativos, al igual que el estudio de ligamiento efectuado por Stein et al 17en 1995. En 1994 Beiraghi y cols 13, realizaron un estudio de ligamiento para los loci D4S175 y D4S192 (4q) dando resultados positivos para este último; no obstante, Stein y cols en 199517 comunican resultados negativos. El estudio de asociación para estos mismos loci, efectuado por Mitchell y cols 21 en 1995 da resultados positivos; dicha asociación es más significativa para D4S192. En cuanto a genes HOX ubicados en el cromosoma 4, a la fecha sólo se ha publicado un estudio de ligamiento entre MSX1 y FLPNS por Stein y cols 17 en 1995, cuyos resultados fueron negativos y un trabajo de asociación para este mismo locus, publicado por nuestro grupo, cuyos resultados iniciales bordean la significación 27. El presente trabajo constituye una extensión de dicho estudio, pero considerando para su análisis la variable sexo, tomando en cuenta los antecedentes epidemiológicos de la FLPNS que muestran que la frecuencia de varones afectados es aproximadamente el doble de la de mujeres afectadas.

 

MATERIAL Y MÉTODO

 Se estudiaron 73 probandos con FLPNS, 127 familiares sanos de dichos probandos y 77 individuos normales sin antecedentes de FLPNS los que constituyeron el grupo control. De los 73 probandos con FLPNS, 37 provenían de familias multiplex (más de 1 individuo afectado en la familia) y 34 de familias simplex, es decir, constituían el único caso conocido en la familia. De los 127 familiares sanos, 66 corresponden a familiares de fisurados multiplex y 61 a familiares de fisurados simplex. Los probandos y sus familiares se obtuvieron de aquellos pacientes que concurren en busca de rehabilitación a la Clínica de Fisurados de la Facultad de Odontología de la Universidad de Chile, a la Fundación Alfredo Gantz Mann pro-ayuda al niño fisurado y al Centro de Amigos del Niño Fisurado-Talca. Los controles se obtuvieron de donantes del Banco de Sangre del Hospital Clínico José Joaquín Aguirre de la Universidad de Chile, que no tuviesen antecedentes de FLPNS en sus familias.
A cada individuo seleccionado, previa autorización del mismo, se le extrajo 10 ml de sangre periférica a partir de la cual, se obtuvo DNA genómico, mediante el procedimiento de Poncz et al 28.(1992) En el gen MSX1 se estudió la secuencia microsatélite CA descrita por Padanilam et al 29(1992), la que presenta cuatro alelos y una heterocigocidad de 62%. La secuencia microsatélite se amplificó por PCR utilizando los primeros descritos por Padanilam et al 29 en 1992 (5'TTAGATTGTCATCAGTCCTC y 5'GGGCATGTTGATGTCTGCTGAC). Las amplificaciones se realizaron en 50 µl de reacción conteniendo 50-100 mg de DNA genómico, 1,5 mM  MgCI2; 50 mM Kcl, 10 mM Tris-Hcl (pH 9,0); 0,2 mM de cada dNTP, 50 pmol de partidores y 2,5 unidades de Taq polimerasa. Los ciclos termales se iniciaron con 5 min de denaturación inicial a 94º C, seguidos por 32 ciclos de 1 min a 94º C; 1 min a 50º C y 30 seg a 72º C. Para detectar los alelos, 4 µl del producto se sometieron a electroforesis en geles de acrilamidabisacrilamida al 12% no denaturantes, utilizando Ladder 1 kb como matador de peso molecular. La corrida se efectuó a 600 V por 15 horas y los geles se tiñieron con plata para visualizar los amplificados.

 
RESULTADOS

 La Tabla 1 muestra las frecuencias génicas de los alelos MSX1 en individuos fisurados (totales) en sus familiares sanos (totales) y en un grupo control. La frecuencia del alelo 2 es mayor en los fisurados (0,219) y en sus familiares (0,189) que en el grupo control (0,143). El alelo 3 en cambio presenta una tendencia opuesta, con valores menores en fisurados (0,089) y en sus familiares (0,083) en comparación al grupo control. Estas diferencias, no obstante, no alcanzan significación estadística.
Como la muestra de individuos fisurados incluye a aquellos provenientes de familias simplex (49%) y a aquellos provenientes de familias multiplex (51%) y dado que algunos autores han propuesto que corresponderían a diferentes entidades nosológicas, se efectuó un segundo análisis adscribiendo tanto a los individuos fisurados como a sus respectivos familiares sanos según si provenían de familias simplex o multiplex. Al comparar entre sí estos grupos tampoco se observan diferencias estadísticamente significativas con la sola excepción del alelo 2 entre Fisurados Multiplex vs Controles (X2=4,40; p=0,036) (Tabla 3).

La información epidemiológica sobre la fisura labiopalatina no sindrómica tanto respecto a su incidencia como a su prevalencia muestran un dimorfismo sexual en que la relación varón:mujer afectado se aproxima a 2:1. Por ello subdividimos los distintos grupos descritos según sexo, tal como se muestran en la Tabla 2. Al comparar fisurados varones vs fisurados mujeres, fisurados Sx varones vs Fisurados Sx mujeres y fisurados Mx varones vs fisurados Mx mujeres no se observaron entre ellos diferencias estadísticamente significativas para ninguno de los alelos de Msx-1. Idéntico resultado se obtuvo al comparar a los familiares sanos varones vs familiares sanos mujeres, ya sea agrupados o clasificados en simplex y multiplex. Sin embargo, al comparar a los controles varones vs controles mujeres se observaron diferencias estadísticamente significativas, tanto para el alelo 1 (X2=9,78; p=0,002 (Test de Fisher p=0,002) como para el alelo 4 (X2=8,78; p=0,003). Este resultado obligó a replantear los análisis efectuados anteriormente. Así, se comparó fisurados varones vs controles varones, fisurados mujeres vs controles mujeres, fisurados Mx varones vs controles varones, fisurados Sx varones vs controles varones y así sucesivamente para los demás subgrupos, tal como se muestra en la Tabla 3 en la cual se describen los resultados de X2 para cada alelo en cada comparación.
Los varones fisurados (Sx y totales) presentan una distribución de las frecuencias alélicas de MSX-1 semejantes a las de los varones controles, en cambio los varones fisurados Mx diferen en la frecuencia de los alelos 2 y 4 respecto a la población de varones controles (X2=5,09; p=0,024 y X2=5,57; p=0,022 respectivamente).
Los familiares varones sanos, de probandos fisurados Sx, Mx o totales presentan una distribución de frecuencias alélicas de MSX-1 parecidas a las que presentan los varones controles; en cambio los familiares varones sanos de probandos Mx presentan también diferencias significativas para los alelos 2 y 4, al igual que los varones fisurados multiplex (X2=5,46; p=0,019 y X2=3,97; p=0,044 respectivamente).
Las mujeres fisuradas (Sx, Mx y totales) presentan una distribución de frecuencias alélicas de MSX-1 parecidas a las de las mujeres controles con la sola excepción del alelo 1 de mujeres fisuradas Mx que bordea la significación (X2=4,32; p=0,038) (Test de Fisher p=0,064).
Los familiares mujeres sanas de probandos fisurados  (Sx, Mx y totales) presentan una distribución de frecuencias alélicas de MSX-1 diferente a la de las mujeres controles para los alelos 1 y 4 (X2=4,60; p=0,032 (Test de Fisher p=0,003); X2=5,15; p=0,023; X2=9,35; p=0,002 (Test de Fisher p=0,003); X2=4,47; p=0,034; X2=12,51; p=0,004 (Test de Fisher p=0,001); X2=13,79; p=0,0002 respectivamente).
En resumen, los varones fisurados y sus familiares varones sanos se diferencian de los varones controles debido a las frecuencias conjuntas de los alelos 2 y 4 y en cambio las familiares mujeres sanas difieren de las mujeres controles debido a las frecuencias conjuntas de los alelos 1 y 4.

 
Tabla 1. Frecuencia de los alelos MNX-1 en pacientes con fisura labiopalatina provenientes de familias simplex (Sx), multiplex (Mx) en sus respectivos familiares sanos y en un grupo control
 
Tabla 2. Frecuencia de los alelos MSX-1 en pacientes con fisura labiopalatina provenientes de familias simplex, multiplex en sus respectivos familiares sanos y en un grupo control según sexo
V = Varón; M= Mujer, FL (P)= Pacientes con fisura labiopalatina, (N)= Número de individuos; n= Número de alelos
 
Tabla 3. Valores de X2 de la comparación entre fisurados y
familiares vs controles para el locus MSX1

FT = Fisurados totales FTv = Fisurados totales varones FTm =Fisurados totales mujeres
FSx = Fisurados Simplex FMx = Fisurados Multiplex FSxv = Fisurados Simplex varones
FSxm = Fisurados Simplex mujeres C = Controles CV = Controles varones
Cm = Controles mujeres

FaT   = Fam de fisurados Tot  FaMx = Fam  de fisurados Mx  FaSx = Fam de fisurados Sx
FaTv  = Fam totales varones   FaTm = Fam totales mujeres  FaMxm = Fam Multiplex mujeres
C       = Controles Cv = Controles varones Cm = Controles mujeres
*        = p < 0,05
**      = p < 0,001
 
DISCUSIÓN

Al analizar los diferentes trabajos de asociación entre genes candidatos y FLPNS publicados a la fecha llama la atención que los resultados obtenidos para un mismo locus en ocasiones difieren significativamente en poblaciones étnicamente homogéneas. Ello podría deberse a que no todos los estudios de asociación analizan separadamente la información genealógica proveniente de familias simplex y multiplex. La racionalidad de este procedimiento se basa en el supuesto que las familias simplex y multiplex podrían ser reflejo de un fenómeno de heterogeneidad genética, en el cual estarían involucrados varios loci sin que a ninguno de ellos pueda atribuirse mayoritariamente el fenotipo fisura; este supuesto estaría apoyando el modelo oligogénico y explicaría también los resultados mayoritariamente negativos para los estudios de ligamiento, que suponen que el fenotipo fisura es mayoritariamente la expresión de un gen mayor. El análisis de las frecuencias alélicas tanto en individuos afectados y sanos de familias simplex y multiplex debiera ayudar a dilucidar si las diferencias entre ambos grupos son el reflejo de factores etiológicos diferentes o sólo corresponden a un riesgo diferencial basado en las frecuencias de ciertas combinatorias alélicas de los loci involucrados en la etiología.
Los resultados del presente estudio parecen apoyar la segunda proposición mencionada en el párrafo precedente. A modo de ejemplo, llama la atención que las diferencias estadísticamente significativas entre familiares varones sanos de probandos FLPNS-Mx vs controles varones dependen de las diferencias conjuntas de los alelos 2 y 4. Esta situación no se observa para los probandos varones FLPNS-Sx ni para sus familiares varones sanos. E consecuencia pareciera que esta diferencia conjunta para estos dos alelos permitiera diferenciar ambos grupos. Este resultado no puede atribuirse a un fenómeno derivado de tamaños muestrales insuficientes, pues entonces la significación debería ser mayor en la muestra total de probandos FLPNS (Sx + Mx), situación que no se observa. Para las mujeres probandos con FLPNS no se aprecia un fenómeno asociativo similar. En cambio, las familiares mujeres sanas de probandos mujeres con FLPNS ya sean Sx, Mx o totales muestran diferencias estadísticamente significativas con las mujeres controles para los alelos 1 y 4. Lo que más llama la atención de este resultado es que difieren entre sí, en cuanto a frecuencias alélicas del locus MSX1 mujeres "sanas" (familiares de fisurados y controles) de la misma población; ello pudiera tener su explicación en la siguiente inferencia. Las familiares mujeres sanas de individuos con FLPNS presentan un mayor riesgo de estar afectadas en comparación con las mujeres controles propiamente tales, pero el hecho de estar sanas implicaría que requieren de la interacción con otros loci involucrados en la etiología de la FLPNS para estar afectadas (sin perjuicio de interacciones con medioambientes específicos). Las mujeres fisuradas, en cambio, lo son porque además de las diferencias alélicas con las mujeres controles para MSX-1 deben tener diferencias para otros loci involucrados en la etiología de la FLPNS. La situación que se observa para los varones, tanto en los individuos fisurados como en sus familiares sanos es en este contexto más congruente. Ambos grupos difieren para los mismos alelos, pero sólo uno de ellos está afectado, lo cual también parece reflejar que para estar afectado se requiere de la acción adicional de al menos otros locus.
La explicación de porqué los familiares sanos varones y mujeres presentan diferencias en cuanto a los alelos involucrados en su caracterización es más compleja. En el caso de las mujeres estos alelos no presentan diferencias en sus frecuencias alélicas si provienen de familias simplex o multiplex, lo que estaría indicando que los alelos de este locus sólo participan en la determinación de un riesgo diferencial en una etapa primaria, de la expresión del fenotipo fisura. En cambio en los familiares varones sanos provenientes de familias multiplex, el riesgo diferencial está, en gran medida, determinado por la combinación alélica 2 y 4, la misma que en los FLPNS-Mx por lo que se puede deducir que la sola presencia de este locus, no es suficiente para "marcar" la diferencia entre sano y enfermo en las familias multiplex. No obstante, esta misma inferencia no se puede aplicar a las mujeres con FLPNS o a sus familiares mujeres.
Los resultados del presente trabajo, en el cual sólo se analizan los alelos de un solo locus candidato involucrado en la etiología de la FLPNS, permiten postular que el fenotipo fisura es probablemente el resultado de determinadas combinaciones alélicas de varios loci y que las diferencias entre familias simplex y multiplex corresponden a un riesgo diferencial basado en la frecuencia de ciertas combinaciones alélicas, las que a su vez son dependientes de las frecuencias de tales alelos en las poblaciones. Se requerirá del análisis conjunto de las variaciones alélicas de varios loci en los grupos en estudio del presente trabajo para dilucidar este planteamiento; resultados de los cuales esperamos disponer en un futuro cercano.

 

REFERENCIAS

 1. ARDINGER HH, BUETOW KH, BELL GL ET AL. Association of genefic variation of the transforming growth factor alpha gene with cleft lip and palate. Am J Hum Genet 1989; 45: 348-53.
2. HECHT JT, WANG Y, BLANTON SH, MICHELS VV AND DAIGER SP. Cleft lip and Palate: No evidence of linkage to Transforming Growth Factor Alpha. Am J Hum Genet 1991; 49: 682-6.
3. CHENEVIX-TRENCH G, JONES K, GREEN A AND MARTIN N. Further evidence for an association between genetic variation in Transforming Growth Factor Alpha and Cleft lip and Palate. Am J Hum Genet 1991; 48: 1012-3.
4. STOLL C, QIAN JF, FEINGOLD J, SAUVEGE P AND MAY E. Genetic variation in Transforming Growth Factor Alpha: Possible Association of BamH1 Polymorphism with Bilateral Sporadic Cleft lip and Palate. Am J Hum Genet 1992; 50: 870-1.
5. HOLDER SE, VINTINER GM, FARREN B ET AL. Confirmation of an association between RFLP's at the Transforming Growth Factor-Alpha Locus and Non-syndromic Cleft lip and Palate. J Med Genet 1992; 29: 390-2.
6. VINTINER GM, HOLDER SE, WINTER RM AND MALCOLM S. No evidence of linkage between the Transforming Growth Factor-Alpha gene in families with apparently autosomal dominant inheritance of cleft lip and palate. J Med Genets 1992; 29: 393-7.
7. CHENEVIX-TRENCH G, JONES K, GREEN AC ET AL. Cleft lip with or without cleft palate Associations with Transforming Growth Factor Alpha and Retinoic Acid Receptor Loci Am J Hum Genet 1992; 51: 1377-85.
8. VINTINER GM, LO KK, HOLDER SE ET AL. Exclusion of candidate genes from a role in cleft lip with or without cleft palate: linkage and association studies. J Med Genet 1993; 30: 773-8.
9. SASSANI R, BARTLETT SP, FENG H ET AL. Association between alleles of the Transforming Growth Factor Alpha locus and the occurrence of cleft lip. Am J of Med Genet 1993; 45: 565-9.
10. HECHT JT, WANG Y, CONNOR B ET AL.. Nonsyndromic cleft lip and palate. No evidence of linkage to HLA or factor 13A. Am J Hum Genet 1993; 52: 1230-3.
11. SHAW D, RAY A, MARAZITA M AND FIELD L. Further evidence of a relationship between the retinoic acid receptor alpha locus and nonsyndromic cleft lip with or without cleft palate (CL+P) Am J Hum Genet 1993; 53: 1156-7.
12. JARA L, BLANCO R, CHIFFELLE I ET AL. Fisura labiopalatina en población chilena: asociación con polimorfismo BamH1 del gen factor transformante del crecimiento alfa (TGFA). Rev Méd Chile 1993; 121: 390-5.
13. BEIRAGHI S, FOROUD T, DIOUHY S ET AL. Possible localization of a major gene for cleft lip and palate to 4q. Clin Genet 1994; 46: 255-6.
14. FENG H, SASSANI R, BARTLETT S ET AL. Evidence, from Family Studies for Linkage Disequilibrium between TGFA and a Gene for Nonsyndromic Cleft Lip with or without Cleft Palate. Am J Med Genet 1994; 31: 425.
15. MITCHELL LE. Interpreting the evidence for an association between the retinoic acid receptor locus and non-syndromic cleft lip with or without cleft palate. Am J Med Genet 1994; 31: 425.
16. STEIN J, MULLIKEN JB, STAL S ET AL. Nonsyndromic cleft lip with or without cleft palate: evidence of linkage to BCL-3 in 17 multigenerational families Am J Hunt Genet 1995; 57: 257-72.
17. DAVIES AF, STEPHENS RJ, ALAVESEN MG, HEALTER L, DIXON MJ, MAGGEE A, FLINTER F AND RAGOUSSI  J. Evidence of a locus for orofacial clefting on human chromosome 6p24 and STS content map of the region. Human Molecular Genetics 1995; 4: 121-8.
18. JARA L, BLANCO R, CHIFFELLE I ET AL. Association between alleles of the transforming growth factor alpha and cleft lip and palate in a Chilean population. Am J Med Genet 1995; 57: 548-51.
19. JARA L, BLANCO R, CHIFFELLE I ET AL. Evidence for an association between RFLP's at the transforming growth factor alpha and nonsyndromic cleft lip/palate in a South-American population. Am J Hum Genet 1995; 56: 339-41.
20. CARINCI F, PEZZETTI F, SCAPOLI L ET AL. Nonsyndromic cleft lip and palate: Evidence of linkage to a micrsatellite marker on 6p23. Am J Hum Genet 1995; 56: 337-9.
21. MITCHELL LE, HEALY SC AND CHEVENIX-TRENCH G. Evidence for an association between nonsyndromic cleft lip with or without cleft palate and a gene located on the long arm of chromosome 4. Am J Hum Genet 1995; 57: 1130-6.
22. BLANTON SH, CROWDER E, MALCOLM S ET AL. Exclusion of linkage between cleft lip with or without cleft palate and markers on chromosomes 4 and 6. Am J Hum Genet 1996; 58: 239-41.
23. WYSZYNSKY DF, MAESTRI N, LAVANDA AF ET AL. No evidence of linkage for cleft lip with or without cleft palate to a marker near the transforming growth factor alpha locus in two populations. Hum Hered 1997; 47: 101-9.
24. WYSZYNSKY DF, MAESTRI N, MCINSTOSH E ET AL. Evidence for an association between markers on chromosome 19q and non-syndromic cleft lip with or without cleft palate in two groups of multiplex families. Hum Genet 1997; 99: 22-6.
25. FARRAL M AND HOLDER S. Familial Recurrence-Pattern Analysis of Cleft Lip with or without cleft palate. Am J Hum Genet 1992; 50: 270-7.
26. MITCHELL L AND RISCH N. Mode of inheritance of non-syndromic cleft lip or without clef palate: a reanalysis. Am J Hum Genet 1992; 51: 323-32.
27. JARA L, BLANCO R Y VILLASECA C. Asociación entre la variación genética de MSX1 (Hox-7) y la fisura labiopalatina no sindrómica en población chilena. Enviado para su publicación a Rev Med Chile 1997.
28. PONCZ M, SOLOWIEJCYK D, HARPEL B ET AL. Construction of human gene libraries form small amounts of peripheral blood: analysis of beta-like globin genes. Hemoglobin 1982; 6: 27-36.
29. PADANILAM BJ, STADLER HS, MILLS KA, MC LEOD LB, SOLURSH M, LEE B, RAMÍREZ F, BUETOW KH AND MURRAY JC. Characterization of the human HOX7 cDNA and identification of polymorphic markers. Hum Mol Genet 1992; 1: 407-10.

 
 

 Recibido el 3 de noviembre, 1997. Aceptado el 12 de marzo, 1998.Instituto de Ciencias Biomédicas, Programa de Genética Humana, Facultad de Medicina, Universidad de Chile. Servicio de Genética, Hospital Clínico Universidad de Chile
 

Correspondencia a: Rafael Blanco Castillo. Av. Independencia 1027, Casilla 70061, Correo 7, Santiago, Chile. Fax: 7373158. Fono: 6786457.

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons