SciELO - Scientific Electronic Library Online

 
vol.127 número10Disponibilidad de médicos en Chile y su proyección a mediano plazo. Cinco años despuésBiopsia rápida por congelación en el diagnóstico de tumores de ovario: correlación diagnóstica según diámetro y peso en tumores de origen epitelial índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Revista médica de Chile

versión impresa ISSN 0034-9887

Rev. méd. Chile v.127 n.10 Santiago oct. 1999

http://dx.doi.org/10.4067/S0034-98871999001000006 

Estudio de asociación entre la fisura
labiopalatina no sindrómica y
marcadores de microsatélite
ubicados en 6p

Association between non syndromic
cleft lip palate and microsatellite
markers located in 6p

Hernán Carreño Z, Mónica Paredes A, Gonzalo Téllez G1,
Hernán Palomino Z1, Rafael Blanco C1.

Background: Nonsyndromic cleft lip with or without cleft palate (NSCLP) is a common craniofacial developmental defect. Association studies have suggested that a clefting locus is located on chromosome 6p at or near two possible loci, Factor 13A (FI3A) in the region 6p 25-24 and HLA at 6p 21.3. Aim. To test the hypothesis on the possible presence of a major gene on chromosome 6p associated with NSCLP. Patients and methods: We carried out an association study on a sample of unrelated NSCLP patients from multiplex (Mx) and simplex (Sx) families, of their unaffected relatives and in control individuals. DNA was analyzed with three PCR markers close to the putative NSCLP locus, dinucleotide repeats at loci D6S89, D6S109 and D6S105. PCR products were resolved by PAGE and visualized by silver staining. Statistical analysis was performed by means of c2 log ratio. Results: Significant differences were observed when comparing the allele frequency distribution of D6S89 in patients with NSCLP and controls and in patients with NSCLP-Mx and controls. No significant differences were observed for patients with NSCLP-Sx. D6S109 and D6S105 showed no significant differences in any of the comparisons. Conclusions: Our results support the hypothesis that a NSCLP locus maps on 6p23 very close to D6S89. Results for D6S109 and D6S105 do not show a clear association. Differences observed between NSCLP-MX and Sx families seem to represent different etiologic entities. The results of the present study, plus those already published for candidate loci, TGFA and MSX1, support the hypothesis that several interacting major genes participate in the etiology of NSCLP.
(Key Words: Cleft lip; Cleft palate; Chromosome abnormalities; Lip Diseases)

Recibido el 17 de mayo, 1999. Aceptado en versión corregida el 27 de julio, 1999.
Programa de Genética Humana, Instituto de Ciencias Biomédicas, Facultad de Medicina,
Universidad de Chile.
1 Ayudante Alumno, Carrera de Medicina, Facultad de Medicina, Universidad de Chile.

La fisura labiopalatina no sindrómica (FLPNS) constituye una de las malformaciones congénitas más frecuentes al nacimiento, afectando aproximadamente a 1 en 1.000 nacidos vivos en poblaciones caucásicas1,2. Su frecuencia varía según el origen étnico de la población, siendo baja en aquellas de origen negroide, intermedia en las caucasoides y alta en las de origen mongoloide3,4. En la población chilena existe una heterogeneidad tanto inter como intrapoblacional. Se ha observado que a medida que la proporción de genes amerindios aumenta en la población, aumenta proporcionalmente la incidencia de FLPNS5. Los valores promedios de la población urbana mixta chilena presentan una incidencia de 1,5 x 1.000 nacidos vivos (1,7 x 1.000 para varones y 1,3 x 1.000 para mujeres)6, valores intermedios si se los compara con aquellas predominantemente caucasoides o mongoloides.

En cuanto al modo de herencia de la FLPNS, recientemente ha surgido evidencia de la contribución de un gen mayor en su etiología a partir de los análisis de segregación compleja, realizados en conjuntos de datos genealógicos6-12. Los estudios sobre la etiología genética de la fisura labiopalatina no sindrómica se han realizado utilizando genealogías reconstituidas a partir de probandos afectados. Con el propósito de poder identificar este gen mayor se han realizado estudios de asociación y ligamiento entre el fenotipo fisura y marcadores genéticos moleculares, fundamentalmente en poblaciones de origen caucásico13-18. Estos estudios se han basado en general en el supuesto de un patrón de herencia dominante autosómica. Sin embargo, algunos autores, han sugerido que la contribución genética estaría dada por varios loci de susceptibilidad que interactuarían entre sí19,20. A la fecha los estudios antes mencionados han dado resultados poco alentadores. Los numerosos trabajos de asociación publicados, que han analizado diversos genes candidatos, indican la existencia de más de un locus involucrado en la etiología de la fisura labiopalatina no sindrómica, lo cual implica heterogeneidad genética13-18. Por ello parece constituir una estrategia equivocada continuar con estudios de ligamiento, en tanto no haya certeza de que efectivamente el fenotipo fisura (FLPNS) pueda atribuirse mayoritariamente a un gen mayor en particular (que dé cuenta de más del 80% de la expresión fenotípica). Aún más, ninguno de los estudios de asociación ha analizado separadamente a los probandos afectados, provenientes de familias simplex y múltiplex, ya que numerosos autores plantean se trataría de entidades nosológicas diferentes, conclusión a la que también se llega al aplicar POINTER separadamente a cada grupo de ellas.

De la lectura de los párrafos precedentes se concluye que varios loci ubicados en diferentes cromosomas han sido propuestos como genes candidatos para FLPNS. En un estudio de ligamiento realizado en un grupo de familias con FLPNS por Eiberg et al, éstos propusieron que en 6p la región 6p cercana al locus F13A constituiría una posible región para un locus de fisura21. No obstante, un estudio posterior similar llevado a cabo por Hecht et al, en 1993 no encontró dicho ligamiento22. En 1995 Carinci et al23 llevaron a cabo un estudio similar, pero utilizando 5 marcadores de microsatélite, ubicados en las cercanías del supuesto gen de fisura; ellos incluían un VNTR, el factor F13A24 y cuatro loci con repeticiones dinucleotídicas EDN1, D6S89, D6S105 y D6S10925-28, concluyendo que un posible locus para FLPNS se ubicaría en 6p23, es decir, muy cercano al marcador de microsatélite D6S89.

Davis et al en 1995, también ubican un posible gen de FLPNS en 6p2429. En 1996 Blanton et al, en cambio, comunican resultados negativos30. Cabe señalar que a la disimilitud de resultados se agrega un problema adicional. Mientras Carinci et al23 en 1995, sostienen que la más probable posición para un locus de fisura es D6S89, que es centromérico a EDN1, Davies et al29 en 1995, sugieren un lugar telomérico respecto a EDN1. Además F13A que ha sido implicado en los estudios de asociación iniciales, es telomérico en relación a EDN1. Por lo tanto, la región entre F13A y D6S89 comprende a la región propuesta, tanto por Davis et al29 y por Carinci et al23, en 1995.

En base a los antecedentes expuestos en el presente estudio, se estudiará la posible asociación entre el fenotipo FLPNS y los marcadores de microsatélite D6S89, D6S105 y D6S109 en probandos y en sus respectivos familiares sanos, provenientes tanto de familias simplex como múltiplex, contrastando los resultados con un grupo control, así como con resultados obtenidos por otros autores para verificar si los datos de nuestra población avalan la hipótesis de un gen para fisura en la región 6p antes mencionada.

MATERIAL Y MÉTODO

Los probandos y sus familiares se obtuvieron de pacientes que concurren a la Clínica de Fisurados de la Facultad de Odontología de la Universidad de Chile, a la Fundación Alfredo Gantz Mann Pro-ayuda al Niño Fisurado y al Centro de Amigos del Niño Fisurado de Talca. Los controles se obtuvieron de donantes del Banco de Sangre del Hospital Clínico José Joaquín Aguirre de la Universidad de Chile, que no tuviesen antecedentes de FLPNS en sus familias. A cada individuo seleccionado, previa autorización del mismo, se le extrajo 10 ml de sangre periférica a partir de la cual se obtuvo DNA genómico, mediante el procedimiento de Poncz ET AL 199231. Se estudiaron tres microsatélites: D6S89, D6S109 Y D6S105. Para el marcador D6S89 se analizaron 39 pacientes con FLPNS provenientes de familias múltiplex (FMx), 31 pacientes con FLPNS provenientes de familias simplex (Sx), 61 parientes sanos provenientes de familias múltiplex (Mx), y 58 parientes sanos de familias simplex (Sx). Los controles utilizados fueron 73. Para el marcador D6S109 se utilizaron 35 pacientes FLPNS-Mx, 36 pacientes FLPNS-Sx, 59 parientes sanos de familiares Mx, y 62 parientes sanos de familias Sx. Los controles utilizados fueron 79. Para el marcador D6S105 se utilizaron 45 pacientes FLPNS-Mx, 31 pacientes FLPNS-Sx, 66 parientes sanos Mx, y 48 parientes sanos de familias Sx. Los controles utilizados fueron 83. Los totales de cada grupo considerado para cada microsatélite presentan ligeras variaciones, no obstante que, los tres marcadores utilizados fueron analizados en un mismo individuo de cada grupo. Ello sólo es reflejo de que no siempre se obtuvieron el mismo número de amplificaciones para cada marcador en un mismo individuo de cada grupo o bien que los geles no siempre permitían lecturas óptimas y, por ende, no fueron consideradas.

Las reacciones de amplificación para los microsatélites D6S109, D6S89 y D6S105, fueron realizadas en un termociclador MJ Research.

Se llevaron a cabo en 25 µl de volumen total, conteniendo 50-100 µg de DNA genómico, 1,5 mM MgCl2; 50 mM KCl; 10 mM tris-HCl (pH= 9,0); 0,2 mM DNTPs, y 2,5 Unidades de taq polimerasa. Las concentraciones de los primers (o partidores) utilizadas según el marcador fueron las siguientes: 10 pmoles para D6S109 y 5 pmoles para D6S89 y D6S105. El protocolo de amplificación para D6S109 y D6S89 fue de 32 ciclos, cada ciclo de 1 min a 94°C, 1 min a 59°C y 30 segundos a 72°C. En tanto el protocolo de amplificación de D6S105 fue de 32 ciclos y cada ciclo de 1 min a 94°C, 1 min a 55°C y 30 segundos a 72°C.

Las secuencias de los partidores para D6S109 fueron cadena GT (5’-CAC CCT GGG CAA TAA GAG CG-3’); cadena CA (5’-CCC CTC TTC ATC CTC CCT TTC A-3’) (Ranum y cols, 1991)26. Las secuencias para D6S89 fueron: cadena 1717 (5’-CTT GTT CAT CTG CCT TGT GC-3’) y cadena 1718 (5’-ACC TAA GCG ACT GCC TAA AC-3’) (Ranum ET AL)26. Las secuencias para D6S105 fueron: cadena CA (5’GCC CTA TAA AAT CCT AAT TAA C) y cadena GT (GAAGGAGAATTGTAATTCCG) (Weber y col 1989)27. Los productos de PCR fueron analizados por electroforesis en geles denaturantes al 6% con buffer TBE 1X (89 mM tris, 89 mM ácido bórico, 1,2 mM of EDTA, pH 8,0) a 100 watt por 50 min para D6S109 y D6S89, y 35 min en el caso de D6S105.

Los geles se tiñeron con nitrato de plata a temperatura ambiente según protocolo estándar (J Sambrook, EF Fritsch, T Maniatis. "Molecular Cloning: A Laboratory Manual". 2nd Ed Cold Spring Harbor Laboratory Press, New York 1989)33, que consistían en agregar al gel etanol al 10% por 10 min en agitación continua, retirar el etanol y añadir ácido nítrico al 70% por 3 min. El gel, se lavó con agua destilada, y se agregó una solución al 0,1% de nitrato de plata por 30 min, se lavó con agua destilada por 20 seg y se reveló con una solución al 2,5% de carbonato de sodio, conteniendo 0,02% de formaldehído. Se mantuvo en agitación continua hasta que las bandas de DNA tuvieran el contraste deseado.

RESULTADOS

La Tabla 1 presenta las distribuciones de las frecuencias alélicas del locus D6S89 en dos poblaciones caucásicas26 y en una muestra de controles chilenos. Al comparar esta última con las muestras caucásicas 1 y 2 mediante un ji cuadrado obtenido por la razón de verosimilitud (c2 r.v), se obtuvieron diferencias estadísticamente significativas (caucásica 1 vs controles chilenos, c2= 165,10 (GL=13) p<10-6; caucásica 2 vs controles chilenos, c2= 150,24 (GL=16) p<10-6).

Tabla 1. Frecuencia alélica de D6S89 en poblaciones caucásica y chilena

     
Frecuencias alélicas
   
Alelos
Caucásicos (1)
Caucásicos (2)
Chilena
(pb)
Ranum et al. 1991
Ranum et al. 1991
(presente estudio)
 
N= 93
N= 99
N= 73
 
n
%
n
%
n
%

177 0 0,0 4 2,0 2 1,4
179 2 1,0 2 1,0 0 0,0
181 0 0,0 0 0,0 0 0,0
183 0 0,0 0 0,0 28   19,2
185 30 16,0 40 20,0 0 0,0
187 0 0,0 4 2,0 2 1,4
189 0 0,0 0 0,0 0 0,0
191 5 3,0   10        5,0 74,8
193 11 6,0 2 1,0 6 4,1
195 9 5,0 6 3,0 19   13,0
197 37 20,0 18 9,0 24   16,4
199 41 22,0 12 6,0 6 4,1
201 0 0,0 45 23,0 9 6,2
203 4 2,0 14 7,0 22   15,1
205 32 17,0 25 13,0 20   13,7
207 15 8,0 4 2,0 1 0,7
209 0 0,0 6 3,0 0 0,0
211 0 0,0 4 2,0 0 0,0
213 0 0,0 2 1,0 0 0,0

N= Número de individuos
n= Número de alelos
(1) y (2)= Corresponden a diferentes genealogías extensas de origen caucásico.

La Tabla 2 muestra las frecuencias alélicas del locus D6S89 en una muestra de pacientes con FLPNS provenientes de familias simplex y múltiplex, en una muestra de sus respectivos familiares sanos y en un grupo control. Al comparar el total de la muestra de pacientes con FLPNS vs controles mediante c2 r.v no se observan diferencias estadísticamente significativas, al igual que al comparar la muestra FLPNS-Sx versus controles. Sin embargo, la muestra de pacientes con FLPNS-Mx versus controles muestra diferencias estadísticamente significativas ( c2= 28,04; (GL=14); p=0,014). Al efectuar las comparaciones entre la muestra total de pacientes con FLPNS vs controles para cada alelo, en forma individual, no se observan diferencias significativas para ninguno de ellos; idéntico resultado se observa al comparar la muestra de pacientes con FLPNS-Sx vs controles. En cambio, los FLPNS-Mx vs controles presentan diferencias significativas para los alelos 197 y 203 ( c2= 6,20; p=0,0127 y c2= 6,46; p=0,0110 respectivamente).

Tabla 2. Frecuencias alélicas de D6S89 en pacientes con fisura labiopalatina no sindrómica
simplex o múltiplex, en sus respectivos familiares sanos y en un grupo control

Frecuencia    
Fisurados
       
Familiares
   
Controles
Alélicas
Simplex
Múltiplex
Totales
Simplex
Múltiplex
Totales
N=73
 
N=31
N=39
N=70
N=58

N=61

N=119
   
  n % n % n % n % n % n % n %

1 (177 pb) 2 3,23 0 0,00 2 1,43 0 0,00 1 0,82 1 0,42 2 1,37
2 (179 pb) 0 0,00 0 0,00 0 0,00 0 0,00      0,00 0          0,00 0         0,00  
3 (181 pb) 0 0,00 1 1,28 1 0,71 0 0,00 0 0,00 0 0,00 0 0,00
4 (183 pb) 13 20,97 10 12,82 23 16,43 13 11,21 18   14,75 31   13,03 28   19,18
5 (185 pb) 0 0,00 2 2,56 2 1,43 1 0,86 0 0,00 1 0,24 0 0,00
6 (187 pb) 0 0,00 1 1,28 1 0,71 0 0,00 0 0,00 0 0,00 2 1,37
7 (189 pb) 0 0,00 1 1,28 1 0,71 3 2,59 4 3,28 7 2,94 0 0,00
8 (191 pb) 3 4,84 4 5,13 7 5,00 9 7,76 9 7,38 18   7,56 7 4,79
9 (193 pb) 6 9,68 2 2,56 8 5,71 8 6,90 6 4,92 14   5,88 6 4,11
10 (195 pb) 3 4,84 13 16,67 16 11,43 9 7,76 16   13,11 25   10,50 19   13,01
11 (197 pb) 8 12,90 24 30,77 32 22,86 23 19,83 28   22,95 51   21,43 24   16,44
12 (199 pb) 1 1,61 4 5,13 5 3,57 3 2,59 4 3,28 7 2,94 6 4,11
13 (201 pb) 7 11,29 3 3,85 10 7,14 10 8,62 2 1,64 12   5,04 9 6,16
14 (203 pb) 10 16,13 3 3,85 13 9,29 25 21,55 22   18,03 47   19,75 22   15,07
15 (205 pb) 7 11,29 7 8,97 14 10,00 10 8,62 11   9,02 21   8,82 20   13,70
16 (207 pb) 2 3,23 3 3,85 5 3,57 2 1,72 1 0,82 3 1,26 1 0,68

N=Número de individuos
n=Número de alelos

El análisis para los familiares de estos pacientes muestra que al comparar la muestra total versus controles, así como la muestra de familiares Mx vs controles, utilizando el c2 r.v no se presentan diferencias estadísticamente significativas; sólo la comparación entre familias Sx vs controles alcanza una leve significación estadística (c2= 22,47 (GL=13) p=0,0484). Sin embargo, la comparación entre la muestra total de familiares versus controles, alelo por alelo, muestra diferencias estadísticamente significativas para el alelo 189 ( c2= 4,37; p= 0,0365). También se observa una diferencia estadísticamente significativa para este alelo al comparar los familiares Mx vs controles ( c2= 4,86; p=0,0275). La comparación entre familiares provenientes de familias Sx versus controles no muestra diferencias estadísticamente significativas.

La Tabla 3 presenta las distribuciones de las frecuencias alélicas del marcador de microsatélite D6S109 en una población caucásica28 y en una muestra de controles chilenos. La comparación entre ambas muestras utilizando c2 r.v no muestra diferencias estadísticamente significativas.

Tabla 3. Frecuencia alélica de D6S109
en población caucásica y chilena

 
Población
Frecuencia
Caucásica
chilena
Alélica
(Ranum et al, 1991)
(presente estudio)
 
N= 87
N= 79
 
n
%
n
%

1 (197 pb) 0 0,0 0 0,0
2 (195 pb) 0 0,0 2 1,3
3 (193 pb) 3 2,0 1 0,6
4 (191 pb) 23   13,0   17   10,8  
5 (189 pb) 30   17,0   14   8,9
6 (187 pb) 64   37,0   60   38,0  
7 (185 pb) 23   13,0   34   21,5  
8 (183 pb) 12   7,0 8 5,1
9 (181 pb) 12   7,0 17   10,8  
10 (179 pb) 0 0,0 1 0,6
11 (177 pb) 0 0,0 1 0,6
12 (175 pb) 5 3,0 2 1,3
13 (169 pb) 2 1,0 1 0,6

N=Número de individuos
n=Número de alelos

La Tabla 4 presenta las frecuencias alélicas del locus D6S109, tanto en la muestra total de pacientes con FLPNS como en aquellos provenientes de familias Mx y Sx, así como la muestra total de sus respectivos familiares sanos, a su vez clasificados si provienen de familias Mx y Sx. La comparación de la muestra total de pacientes con FLPNS versus controles mediante c2 r.v así como la comparación entre pacientes FLPNS-Sx y FLPNS-Mx vs controles no mostraron diferencias estadísticamente significativas. Al comparar individualmente las frecuencias alélicas de la muestra total de FLPNS vs controles sólo el alelo 193 mostró diferencias significativas (c2= 7,65; p=0,00598). Idéntico resultado se obtiene en el caso de FLPNS-Mx versus controles, sólo el alelo 193 mostró diferencias estadísticamente significativas (c2= 8,02; p=0,0046). En cambio al comparar a los pacientes con FLPNS-Sx, se observaron diferencias significativas, tanto para el alelo 197 como para el alelo 193 (c2= 6,67; p=0,0098 y c2= 5,64; p=0,01759 respectivamente). Al comparar la muestra total de familiares versus controles y submuestra de familiares sanos Mx y Sx versus controles, no se observaron diferencias significativas.

Tabla 4. Frecuencias alélicas de D6S109 en pacientes con fisura labiopalatina no sindrómica
simplex o múltiplex, en sus respectivos familiares sanos y en un grupo control

Frecuencia    
Fisurados
       
Familiares
   
Controles
Alélicas
Simplex
Múltiplex
Totales
Simplex
Múltiplex
Totales
N= 79
 
N= 36
N= 35
N= 71
N= 62

N= 59

N= 121
   
  n % n
%
n
%
n
%
n
%
n
%
n
%

1 (197 pb) 3 4,2 0 0,0 3 2,1 2 1,6 0 0,0 2 0,8 0 0,0
2 (195 pb) 1 1,4 0 0,0 1 0,7 0 0,0      1 0,9  1 0,4 2 1,3
3 (193 pb) 4 5,6 5 7,1 9 6,3 3 2,4 4 3,4 7 2,9 1 0,6
4 (191 pb) 7 9,7 12 17,1 19 13,4 17 13,8 16 13,7 33 13,6 17 10,8
5 (189 pb) 7 9,7 5 7,1 12 8,5 12 9,8 6 5,1 18 7,4 14 8,9
6 (187 pb) 26 36,1 26 37,1 52 36,6 46 37,4 38 32,5 84 34,7 60 38,0
7 (185 pb) 13 18,1 12 17,1 25 17,6 25 20,3 35 29,9 60 24,8 34 21,5
8 (183 pb) 4 5,6 1 1,4 5 3,5 6 4,9 2 1,7 8 3,3 8 5,1
9 (181 pb) 7 9,7 6 8,6 13 9,2 10 8,1 14 12,0 24 10,0 17 10,8
10 (179 pb) 0 0,0 1 1,4 1 0,7 0 0,0 0 0,0 0 0,0 1 0,6
11 (177 pb) 0 0,0 1 1,4 1 0,7 2 1,6 2 1,7 4 1,7 1 0,6
12 (175 pb) 0 0,0 0 0,0 0 0,0 1 0,8 0 0,0 1 0,4 2 1,3
13 (169 pb) 0 0,0 1 1,4 1 0,7 0 0,0 0 0,0 0 0,0 1 0,6

N= Número de individuos
n= Número de alelos

La Tabla 5 presenta las distribuciones de las frecuencias alélicas del marcador de microsatélite D6S105 en una muestra de origen caucásico27 y en una muestra de controles chilenos. La comparación entre ambas muestras utilizando c2 r.v no mostró diferencias significativas.

Tabla5. Frecuencia alélica de D6S105
en población caucásica y chilena

 
Población
Frecuencia
Caucásica
chilena
Alélica
(Weber y Cols, 1991)
(presente estudio)
 
N= 31
N= 83
 
n
%
n
%

1 (116 pb) 1 2,0 5 3,0
2 (118 pb) 0 0,0 4 2,0
3 (120 pb) 0 0,0 3 2,0
4 (122 pb) 1 2,0 9 5,0
5 (124 pb) 8 13,0   16   10,0  
6 (126 pb) 5 8,0 26   16,0  
7 (128 pb) 24   39,0   53   32,0  
8 (130 pb) 9 14,0   19   11,0  
9 (132 pb) 7 11,0   12   7,0
10 (134 pb) 3 5,0 4 2,0
11 (136 pb) 2 3,0 9 5,0
12 (138 pb) 2 3,0 6 4,0

N= Número de individuos
n= Número de alelos

 

La Tabla 6 muestra las frecuencias alélicas del locus D6S105 en la muestra total de pacientes con FLPNS, en las submuestras de pacientes FLPNS-Mx y FLPNS-Sx, en la muestra total de sus respectivos familiares sanos y en las submuestras de familiares provenientes de familias Mx y Sx. La comparación de la muestra total de pacientes con FLPNS versus controles, así como la comparación entre pacientes FLPNS-Mx y FLPNS-Sx mediante un c2 r.v no presentan diferencias significativas. Al comparar individualmente las frecuencias alélicas entre la muestra total de FLPNS versus controles se observan diferencias significativas para los alelos 122, 130 y 136 (c2= 4,01; p=0,0453, c2= 4,95; p=0,0261 y c2= 4,01; p=0,04535 respectivamente). En cambio la comparación individual alelo por alelo entre FLPNS-Mx y FLPNS-Sx versus controles no mostró diferencias significativas. Al efectuar la comparación de la muestra total de familiares versus controles así como la de familiares provenientes de familias Mx y Sx mediante un c2 r.v no se observan diferencias significativas. Al comparar individualmente las frecuencias alélicas entre la muestra total de familiares sanos vs controles sólo los alelos 122 y 124 muestran diferencias significativas (c2= 5,48; p=0,0191 y c2= 5,40; p=0,0200 respectivamente). Al comparar los familiares provenientes de familias Mx versus controles, también, sólo los alelos 122 y 124 muestran diferencias significativas (c2= 7,38; p=0,0065 y c2= 5,36; p= 0,02059 respectivamente). La comparación entre familiares provenientes de familias Sx vs controles no mostró diferencias significativas.

Tabla 6. Frecuencias alélicas de D6S105 en pacientes con fisura labiopalatina no sindrómica
simplex o múltiplex, en sus respectivos familiares sanos y en grupo control

Frecuencia    
Fisurados
       
Familiares
   
Controles
Alélicas
Simplex
Múltiplex
Totales
Simplex
Múltiplex
Totales
N= 83
 
N= 31
N= 45
N= 76
N= 48

N= 66

N= 114
   
  n % n % n % n % n % n % n %

1 (116 pb) 3 4,17 3 3,57 6 4,11 2 2,08 0 0,00 2 0,88 5 3,01
2 (118 pb) 4 5,56 1 1,19 5 3,42 2 2,08    3 2,27  5 2,19 4 2,41
3 (120 pb) 0 0,00 3 3,57 3 2,05 2 2,08 3 2,27 5 2,19 3 1,81
4 (122 pb) 1 1,39 1 1,19 2 1,37 3 3,13 0 0,00 3 1,32 9 5,42
5 (124 pb) 9 12,5   13 13,10 22 13,70 16 16,17 25 18,94 41 17,98 16 9,64
6 (126 pb) 7 9,72 11 13,10 18 12,33 12 12,50 27 20,45 39 17,10 26 15,66
7 (128 pb) 25 34,72 38 40,48 63 40,41 31 32,59 43 32,58 74 32,45 53 31,93
8 (130 pb) 2 2,78 5 5,95 7 4,79 10 10,42 12 9,09 22 9,65 19 11,45
9 (132 pb) 8 11,11 8 9,52 16 10,95 8 8,33 6 4,55 14 6,14 12 7,23
10 (134 pb) 0 0,0 5 5,95 5 3,42 2 2,08 7 5,30 9 3,95 4 2,41
11 (136 pb) 1 1,39 1 1,19 2 1,37 4 4,17 3 2,27 7 3,07 9 5,42
12 (138 pb) 2 2,78 1 1,19 3 4,17 4 4,17 3 2,27 7 3,07 6 3,61

N= Número de individuos
n= Número de alelos

DISCUSIÓN

Al analizar los diferentes trabajos de asociación o ligamiento entre genes candidatos y FLPNS publicados a la fecha, llama la atención que los resultados obtenidos, para un mismo locus, en ocasiones difieran significativamente en poblaciones étnicamente homogéneas. Ello podría deberse a que no todos los estudios de asociación analizan separadamente la información genealógica proveniente de familias simplex y múltiplex. La racionalidad de este procedimiento se basa en el supuesto que las familias simplex y múltiplex podrían constituir entidades nosológicas independientes o representar un fenómeno de heterogeneidad genética. Más aún, un estudio relativamente reciente sugiere que varios genes mayores interactuantes (oligogenes), en número de cuatro o más loci podrían ser responsables en algunas poblaciones de la etiología genética de la FLPNS18.

El análisis de las frecuencias alélicas de los marcadores de microsatélite en los individuos afectados como en sus familiares sanos, tanto aquellos provenientes de familias simplex como múltiplex debiera ayudar a dilucidar si las diferencias entre ambos grupos son reflejo de factores etiológicos diferentes o sólo corresponden a riesgos diferenciales, basados en las frecuencias de asociación entre éstos y potenciales genes candidatos ubicados adyacentes a éstos. Ello a su vez, sería dependiente de la frecuencia poblacional de los supuestos genes candidatos, localizados en las regiones cromosómicas analizadas.

Los resultados del presente estudio aportan evidencia adicional de que, en la región 6p23 se localizaría un locus para FLPNS muy cercano al marcador de microsatélite D6S89. Esta aseveración se basa en que de todos los marcadores analizados en el presente estudio, el marcador de microsatélite que muestra las más significativas diferencias estadísticas entre la muestra de fisurados y controles es D6S89, las cuales disminuyen progresivamente para D6S109 y D6S105. Ello concuerda con la hipótesis de un locus para fisura en la región 6p23, planteada por otros autores23-29, pues D6S89 se localiza adyacente a HLA y a F13A a una distancia de 15 cM de cada uno. Un hecho que llama poderosamente la atención al respecto es que, sólo en el caso de D6S89 la comparación entre poblaciones caucásicas y la muestra de controles chilenos presenta diferencias altamente significativas, hecho que no se presenta para D6S109 y D6S105. Ello estaría implicando que, con respecto a la zona 6p donde se propone estaría ubicado un gen candidato para FLPNS presenta diferencias entre las poblaciones de controles normales donde se ubica el marcador de microsatélite. Ello implica la existencia de un correlato entre la población caucásica y la chilena para esta zona, lo que implicaría que, la población chilena debería presentar una mayor susceptibilidad para fisura en aquellos casos en que esta zona sea determinante en la expresión del fenotipo fisura.

Esta hipótesis, a su vez, se ve avalada al analizar los resultados de las comparaciones entre las muestras de fisurados total, múltiplex y simplex vs controles, mediante el análisis de ji cuadrado obtenido por la razón de verosimilitud. En este análisis nuevamente sólo el marcador de microsatélite D6S89 presenta diferencias estadísticamente significativas para el caso de FLPNS, cuyos probandos provienen de familias múltiplex, lo que estaría sustentando la hipótesis de que los casos provenientes de familias simplex y múltiplex representan entidades independientes. Ello a su vez se sustenta en el hecho que al analizar posibles diferencias entre fisurados totales, Mx y Sx vs controles alelo por alelo nuevamente sólo los fisurados Mx presentan diferencias significativas respecto a controles para los alelos 197 y 203. Al efectuar idéntico análisis para los marcadores de microsatélite D6S109 y D6S105 también se observan diferencias en la comparación alelo por alelo, pero éstas no presentan un patrón tan consistente como en el caso de D6S89. En el caso de D6S109 las diferencias observadas se centran fundamentalmente en el alelo 193 para todas las comparaciones (fisurados totales, Mx y Sx vs controles), con la excepción de FLPN-Sx vs Co que presenta una diferencia significativa para el alelo 197.

El análisis de los resultados en los familiares sanos de los probandos afectados sustenta aún más las conclusiones detalladas en los párrafos precedentes. Al comparar los familiares sanos vs controles, sea la muestra total de ellos o de aquellos provenientes de familias Mx o Sx, éstos no muestran diferencias significativas para ninguno de los marcadores de microsatélite analizados, con la sola excepción de familias Sx vs controles para el marcador D6S89; no obstante, el valor alcanzado es sólo levemente significativo, pudiendo ello deberse a un problema de tamaño muestral. El análisis de comparación alelo por alelo mediante un ji cuadrado muestra para D6S89 una cierta consistencia, ya que tanto la comparación entre la muestra total de familiares vs controles como la muestra de familiares provenientes de familias Mx alcanzan la significación para el alelo 189, pero no para el caso de familiares Sx versus controles. En el caso del marcador D6S109 no se observa significación para ninguna de las comparaciones antes mencionadas y para D6S105 se observan diferencias significativas en la comparación de la muestra de familiares totales vs controles y de la submuestra de familiares Mx versus controles para los alelos 122 y 124. Los resultados obtenidos de los análisis efectuados en los familiares sanos, son de más difícil interpretación, ya que no presentan una tendencia que pueda asociarse con los resultados obtenidos para los probandos. El único caso en que se observa una relación es para D6S89 en que el análisis alelo por alelo muestra que tanto para los probandos como para los familiares, la comparación de las muestras totales muestran significación estadística al igual que las muestras de FLPNS-Mx y familiares Mx. En el caso de D6S109 no hubo diferencias significativas y para D6S105 sólo las comparaciones entre la muestra total y la submuestra de familiares múltiplex versus controles mostraron diferencias significativas. En consecuencia, si bien los resultados obtenidos para los familiares sanos no presentan una gradiente, cuyos resultados se hagan más significativos en cuanto a su mayor o menor cercanía a la región telomérica de 6p, como en el caso de los probandos afectados, éstos a lo menos indican que, las diferencias observadas entre familiares sanos y población control serían reflejo de que constituyen un grupo de alto riesgo como potenciales progenitores.

En resumen los resultados del presente trabajo, parecen apoyar la hipótesis de que, las diferencias observadas entre probandos provenientes de familias simplex y múltiplex son el reflejo de factores etiológicos diferentes. Además, nuestros resultados indican que un locus para FLPNS se ubicaría adyacente o muy cercanamente al marcador de microsatélite D6S89. Por otra parte, se puede deducir que la sola presencia de este locus no es suficiente para explicar el fenotipo FLPNS, basados en los hallazgos de asociación positiva que hemos encontrado para este mismo grupo en estudio con los loci TGFA33 y MSX1 (Hox-7)34 anteriormente publicados, lo cual apoya fuertemente la hipótesis de que, en la etiología genética de la FLPNS participan interactivamente varios genes mayores.

Correspondencia a: Dr. Rafael Blanco Castillo. Av. Independencia 1027. Casilla 70061. Tel. 2786457. Fax: 7373158. E-mail: rblanco@machi.med.uchile.cl

REFERENCIAS

1. FRASER FC. Genetics of cleft lip and cleft palate. Am J Hum Genet 1970; 22: 336-52.        [ Links ]

2. BONAITI-PELLIE C, BRIAND ML, FEINGOLD ET AL. An epidemiological and genetic study of facial clefting in France. I. Epidemiological and frequency in relatives. J Med Genet 1982; 11: 374-7.        [ Links ]

3. BLANCO R, ROSALES CJ. Diferencias étnicas y dimorfismo sexual de la fisura labiopalatina. Rev Méd Chile 1988; 24: 216-25.        [ Links ]

4. VANDERAS AP. Incidence of cleft lip, cleft palate and cleft lip and palate among races: a review. Cleft Palate J 1987; 24: 216-25.        [ Links ]

5. PALOMINO HM, PALOMINO H, CAUVI D ET AL. Facial clefting and Amerindian admixture in populations of Santiago, Chile. Am J Hum Biol 1997; 99: 225-32.        [ Links ]

6. PALOMINO H, CERDA-FLORES RM, BLANCO R, PALOMINO HM, BARTON SA, DE ANDRADE M ET AL. Complex seggregation analysis of facial clefting in Chile. J Craniofac Genet Dev Biology 1997; 17: 57-64.        [ Links ]

7. DEMEINS F, CHUNG CS, BONNAITI -PELIE D, BRIARD ML, FEINGOLD J. An epidemiological and genetic study of facial clefting in France II. Segregation analysis. J Med Genet 1984; 21: 436-40.        [ Links ]

8. MARAZITA ML, GOLDSTAIN AM, SMALLEY SL, SPENCE MA. Cleft lip with or without cleft palate: reanalysis of a three generation family study from England. Genetic Epidemiology 1986; 3: 335-42.        [ Links ]

9. CHUNG CS, BIXLER D, WATANABE , KOGUCHI H, FOGH ANDERSEN P. Segregation analysis of cleft lip with or without cleft palate: a comparison of Danish and Japanese data. Am J Hum Genet 1986; 39: 603-11.        [ Links ]

10. HECHT JT, WANG Y, BLANTON SH, MICHELS VV, DAIGER SP. Cleft lip and Palate: No evidence of linkage to Transforming Growth Factor Alpha. Am J Hum Genet 1991; 49: 682-6.        [ Links ]

11. RAY AK, LEIGH L, MARAZITA ML. Nonsyndromic cleft lip with or without cleft palate in West Bengal, India: evidence for an autosomal major locus. Am Hum Genet 1993; 52: 1006-11.        [ Links ]

12. BLANCO R, ARCOS-BURGOS M, PAREDES M, PALOMINO H, JARA L, CARREÑO H ET AL. Complex segregation analysis of nonsyndromic cleft lip/palate in the Chilean population. Molecular Biology 1998; 21: 139-44.

13. ARDINGER HH, BUETOW KH, BELL GL, BARDARCH J, VAN-DEMARK DR, MURRAY JC. Association of genetic variation of the transforming growth factor alpha gene with cleft lip and palate. Am J Hum Genet 1989; 45: 348-53.        [ Links ]

14. HECHT JT, WANG Y, CONNOR B, BLANTON SH, DAIGER SP. Nonsyndromic cleft lip and palate. No evidence of linkage to HLA or factor 13A. Am J Hum Genet 1993; 52: 1230-33.        [ Links ]

15. CHENEVIX -TRENCH G, JONES K, GREEN AC, DUFFI DL, MARTIN NG. Cleft lip with or without cleft palate. Associations with Transforming Growth Factor Alpha and Retinoic Acid Receptor Loci. Am J Hum Genet 1992; 51: 1377-85.        [ Links ]

16. SASSANI R, BARTLETT SP, FENG H, GOLDNER-SAUVE A, HAP AH, BURON KH ET AL. Association between alleles of the Transforming Growth Factor-Alpha locus and the occurrence of cleft lip. Am J Med Genet 1993; 45: 565-9.        [ Links ]

17. WYSZYNSKY DF, MAESTRI N, LAVANDA AF, MCINTOSH I, ANNE-SMITH E, GARCÍA-DELGADO C ET AL. No evidence of linkage for cleft lip with or without cleft palate to a marker near the transforming growth factor alpha locus in two populations. Hum Hered 1997; 47: 101-9.        [ Links ]

18. FARRAL M, HOLDER S. Familial Recurrence-Pattern Analysis of Cleft Lip with or without cleft palate. Am J Hum Genet 1992; 50: 270-7.        [ Links ]

19. LIDRAL A, MURRAY J, BUETOW K, BASART A, SCHEARE H, SHIANG R ET AL. Studies of the candidate of the candidate genes TGFB2, MSX1, TGFA, and TGFB3 in the etiology of cleft lip and palate in the Philippines. Cleft Palate Craniofac J 1997; 34: 1-6.        [ Links ]

20. MITCHELL L, RISCH N. Mode of inheritance of non-syndromic cleft lip or without cleft palate: a reanalysis. Am J Hum Genet 1992; 51: 323-32.        [ Links ]

21. EIBERG H, BIXLER D, NIELSEN LS, CONNEALLY PM, MOHR J. Suggestion of linkage of a major locus for nonsyndromic orofacial cleft with F13A and tentative assignment to chromosome 6. Clin Genet 1987; 32: 129-32.        [ Links ]

22. HECHT JT, WANG Y, CONNOR B, BLANTON SH, DIAGER SP. Nonsyndromic cleft lip and palate No evidence of linkage to HLA or factor 13A. Am J Hum Genet 1993; 52: 1230-3.        [ Links ]

23. CARINCI F, PEZZETTI F, SCAPOLI L, PADULA E, BACILIERO V, CURIONI C ET AL. Nonsyndromic cleft lip and palate: Evidence of linkage to a microsatellite marker on 6p23. Am J Hum Genet 1995; 56: 337-9.        [ Links ]

24. PORYMELOPOULUS MH, RATCH DS, XIAO H, MERRIL CR. Tetranucleotide repeat polumorphism at the human coagulation factor XIII A subunit gene (F13A1). Nucleic Acids Res 1991; 19: 4306.        [ Links ]

25. AGES JC, DRIEU C, BLANCHE H, BECKEMANN J, CANN HM. A short tandem repeat polymorphism at the endothelin 1 (EDN1) locus. Hum Mol Genet 1993; 2: 90.        [ Links ]

26. RANUM LPW, DUVICK LA, STEPHEN RS, SHUT J, ITT M, ORR H. Localization of the autosomal dominant HLA-linked spinocerebellar ataxia (SCAI) locus, in two kindreds, within an 8cM subregion of chromosome 6p. Am J Hum Genet 1991; 49: 31-41.        [ Links ]

27. WEBER JJ, KWITEK AF, MAY PE, ZOGHBI HY. Dinucleotid repeat polymorphism at the D6S105 locus. Nucleic Acids Research 1991; 19: 968.        [ Links ]

28. RANUM LPW, CHUNG MY, DUVICK LA ET AL. Dinucleotide repeat polymorphism at the D6S109 locus. Nucleic Acids Res 1991; 19: 1171.        [ Links ]

29. AVIES AF, STEPHENS RJ, ALAVESEN MG, HEATHER L, DIXON M, MAGEE A ET AL. Evidence of a locus for orofacial clefting on human chromosome 6p24 and STS content map of the region. Hum Mol Genet 1995; 4: 121-8.        [ Links ]

30. BLANTON SH, CROWDER E, MALCOLM S, WINTER R, GASSER DL, STAL S ET AL. Exclusion of linkage between cleft lip with or without cleft palate and markers on chromosomes 4 and 6. Am J Hum Genet 1996; 58: 239-41.        [ Links ]

31. PONCZ M, SOLOWIEJCYK D, HARVEL B ET AL. Construction of human gene libraries from small amounts of peripheral blood: analysis of beta-like globin genes. Hemoglobin 1982; 6: 27-36.        [ Links ]

32. SAMBROOK J, FRITSCH E, MANIATIS T. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Laboratory Press 1989.        [ Links ]

33. JARA L, BLANCO R, CHIFFELLE , PALOMINO H, CARREÑO H. Association between alleles of the transforming growth factor alpha and cleft lip and palate in a Chilean population. Am J Med Genet 1995; 57: 548-51.        [ Links ]

34. BLANCO R, JARA L, VILLASECA C, PALOMINO Z, CARREÑO H. La variación genética de MSX1 presenta un dimorfismo sexual en la fisura labiopalatina no sindrómica en población chilena. Rev Méd Chile 1998; 126: 781-7.        [ Links ]

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons