SciELO - Scientific Electronic Library Online

 
vol.132 número11Helicobacter pylori: 20 años despuésEpidemiología de la Insuficiencia Renal Aguda grave: Un estudio prospectivo multicéntrico en la Región Metropolitana índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

Compartilhar


Revista médica de Chile

versão impressa ISSN 0034-9887

Rev. méd. Chile v.132 n.11 Santiago nov. 2004

http://dx.doi.org/10.4067/S0034-98872004001100002 

 

Rev Méd Chile 2004; 132: 1345-1354

Artículos de Investigación

 

Relación de la genotipificación de Helicobacter pylori con la forma e intensidad de la gastritis en población adulta portadora de patología gástrica benigna

Association between helicobacter pylori genotype and the severity of gastritis in infected adults

 

Juan Carlos Araya O, Leonardo Anabalón R, Iván Roa E, María Bravo E, Miguel Ángel Villaseca H, Pablo Guzmán G, Juan Carlos Roa S.

Departamentos de Anatomía Patológica y de Medicina Interna, Facultad de Medicina, Universidad de La Frontera, Temuco, Chile.

Dirección para Correspondencia :


Background: The damaging capacity of Helicobacter pylori is variable and depends, in part, on its genetic polymorphism. Aim: To study H pylori genes vacA, cagA and iceA and the relationship of these genotypes with the features of acute damage in chronic gastritis. Material and methods: Gastric endoscopic biopsies were obtained in 75 adults for pathological study and genetic typification of H pylori by specific PCR. Results: In only 64 cases, complete information was available. In 53 of these, there was H pylori infection demonstrated by PCR. Twenty one percent had infection by two or more H pylori strains, vacA gene had genotypes s2/m2, s1/m1 and s1/m2 in 36, 25 and 8% of cases respectively, cagA gene was present in 49% of infected patients. iceA gene had genotypes iceA 1 ad iceA 2 in 15 and 60% of patients respectively. The presence of cagA or alleles s1/m1 and s1/m2 of vacA gene was directly correlated with polymorphonuclear infiltration and the severity of epithelial damage. The genotype s2/m2 of vacA gene was significantly associated with a milder or absent mucosal damage. No association was found between iceA alleles and the pathological features of gastritis. Conclusions: Alleles of vacA and cagA genes of H pilory are associated with the severity of gastric mucosal damage.

(Key Words: Gastritis; Genes, bacterial; Helicobacter pylori)


 

En países en vías de desarrollo, la prevalencia de infección por Helicobacter pylori alcanza cifras de aproximadamente 80-90% de la población total1-3. No obstante, no más de 3% de estos individuos presentará, en algún momento de su vida, sintomatología o manifestaciones clínicas atribuibles a la infección, tales como úlcera péptica, cáncer gástrico o linfoma gástrico4. Estas evidencias contrastan con el viraje conceptual acerca de la capacidad patogénica, ya que en un principio a H pylori se le había considerado como un mero comensal5, pero desde su redescubrimiento, por Marshall y Warren6, a H pylori se le clasificó como parásito estricto.

La citotoxina vacuolizante vacA induce vacuolización citoplasmática en condiciones experimentales, tanto in vitro como in vivo. Aunque casi todas las cepas de H pylori poseen el gen que codifica esta proteína, sólo algunos son capaces de producirla2,7,8, explicable por el particular mosaicismo de sus alelos. Otro factor patogénico de H pylori es una proteína de mayor peso molecular que la anterior, codificada por el gen cagA, expresado aproximadamente en 45% de las infecciones por H pylori2. En este caso casi todas las cepas de H pylori que poseen este gen son capaces de producir y secretar tal citotoxina7. Finalmente, iceA es un gen descrito más recientemente, con dos formas alélicas distinguibles (1 y 2), que se expresarían cuando la bacteria toma contacto íntimo con las células epiteliales gástricas9.

Aún está pendiente la calibración completa del efecto poblacional en el riesgo de enfermedad diferencial, dado que la existencia o no de infestación y la presencia de diferentes alelos en H pylori no explican plenamente las diferentes tasas de enfermedad en base a la edad de los individuos y distintos sitios geográficos. La clave debe residir en la interacción entre el medio ambiente, la bacteria y el individuo. Mientras tanto, se han realizado diferentes esfuerzos por identificar y describir las cepas infectantes de H pylori, relacionándolas, por un lado, con el tipo de inflamación gástrica10-14 y, por otro, con las diferentes enfermedades en que se ha demostrado que este germen constituye un factor causal12,15-18.

El objetivo del trabajo fue estudiar, en una población adulta portadora de patología gástrica no neoplásica (dispepsia no ulcerosa), la relación existente entre el tipo de cepas de H pylori infectantes en el estómago y el tipo e intensidad de la gastritis.

Material y método

Selección de pacientes: Al estudio se ingresó un total de 75 individuos, excluyéndose los resultados de 11 individuos (n=64). El estudio histopatológico completo fue factible de realizar en 69 de 75 individuos, excluyéndose cinco pacientes por material insuficiente (sin el espesor completo de la mucosa) y uno por hallazgo de adenocarcinoma gástrico. Por otro lado, en otros 5 individuos fracasó la extracción de ADN, con ausencia de amplificación de ß-globina. Los individuos adultos consultaron en la Unidad de Endoscopia Digestiva del Consultorio Miraflores (Servicio de Salud Araucanía Sur, Temuco). Por consentimiento informado firmado, los pacientes aceptaron que sus antecedentes clínicos y demográficos, más una parte del material obtenido para biopsia fuese utilizado para este trabajo. Los criterios de selección final fueron ausencia de cáncer gástrico, ausencia de historia ulcerosa previa, sin tratamiento de erradicación previa de H pylori, sin uso de antagonistas H2 en las dos semanas previas a la endoscopia ni de inhibidores de bomba de protones cuatro semanas precedentes a la endoscopia. En cada uno de ellos se recolectó antecedentes personales y clínicos, los cuales fueron almacenados en forma ciega por quienes realizaron los estudios morfológicos y de biología molecular. El protocolo de trabajo fue autorizado por comités de ética de la Facultad de Medicina de la Universidad de La Frontera y de la Dirección del Servicio de Salud Araucanía Sur.

Extracción de ADN bacteriano: En cada paciente se procesó muestra de mucosa gástrica antral. Cada espécimen fue transportado en tubos con tampón de lisis (10 mM Tris pH 7,8, 5 mM EDTA pH 8,0, 0,5% SDS). La extracción de ADN se realizó según protocolo de aislamiento de ADN desde tejido fresco (Genomic Puregene, Gentra, USA). En resumen, se le adicionó proteinasa K 20 mg/mL, con incubación a 65°C hasta observar lisis total del tejido. Las proteínas fueron descartadas por precipitación con acetato de amonio 7,5 M pH 7,5. El ADN fue precipitado con isopropanol, lavado con etanol 70% y resuspendido en solución tampón TE (10 mM Tris pH 7,8, 5 mM EDTA pH 8,0).

Amplificación de ADN mediante PCR: Primero se realizó reacción de PCR anidado a cada muestra de ADN para búsqueda de H pylori. Los partidores empleados fueron (5'CCCTCACGCCATCAGTCCCAAAAA3') y (5'AAGAAGTCAAAAACGCCCAA AAC3') para la primera reacción, consistente de 40 ciclos y (5'GCCAAATCATAAGTCCGCAGAA 3') y (5'TGAGACTTTCCTAGAAGCGGTGTT 3') para la segunda reacción, consistente de 25 ciclos19. Los productos amplificados de 230 bp fueron sometidos a electroforesis en gel de agarosa y teñido con bromuro de etidio (Figura 1). Para evaluar la calidad y rendimien to de la extracción de ADN se ocupó la presencia de productos de PCR del gen de ß-globina humana20.



Figura 1. Gel de agarosa al 1% teñido con bromuro de etidio. En los carriles 1, 3-5 y 7-11 se observan bandas a nivel de 230 bp, de acuerdo a marcador de ADN visible en el carril (M). Tales productos de la amplificación corresponden a segmentos específicos del genoma de H pylori.

Genotipificación bacteriana (PCR): Los partidores y las condiciones de PCR tipo específico con termociclador (MJ Research, PTC 200) para alelo-tipificación de genes vacA e iceA, y para indagar la presencia de gen cagA se muestran en la Tabla 1. Los productos amplificados fueron sometidos a electroforesis en gel de agarosa y teñido con bromuro de etidio (Figura 2).



Figura 2. Geles de agarosa al 1% teñidos con bromuro de etidio. A la izquierda geles de productos de amplificación de gen vacA, correspondientes a las porciones media (A: m1; B: m2) y señal (C: s1 y s2). En cada uno de ellos la banda del producto de PCR correspondiente está marcado con flecha y el tamaño en pares de bases, de acuerdo al marcador del carril (M). En el gel C los productos s1 y s2 se distinguen por una diferencia en la migración, producto de diferencia de tamaño de 27 bp. Arriba a la derecha gel de productos de amplificación de gen cagA, con presencia de banda a 349 bp en los carriles 1, 3, 4 y 8-11. Abajo a la derecha, gel de gen iceA, separando por línea los carriles 1-8 y 9-13, correspondientes a la amplificación de alelos iceA1 e iceA2, respectivamente. El alelo iceA1 se observa amplificado en los carriles 3 y 7. Por otro lado, el alelo iceA2 se puede visualizar por amplificación de uno o dos productos de PCR en forma simultánea: 229 bp y 334 bp; concomitancia que se observa en el carril 12, y alternancia que se ve en los carriles 10, 11 y 13.



Estudio histopatológico: Para el examen histopatológico se utilizó protocolo de acuerdo a pautas previamente publicadas21, con escalas visuales analógicas22, utilizando dos muestras de antro; una de la curvatura mayor y otra de la incisura angular. Los cortes histológicos fueron teñidos con hematoxilina-eosina, azul alciano pH 2,5, ácido periódico de Schiff y giemsa modificado. Dicho examen fue realizado por 2 observadores en forma independiente, aceptándose sólo casos con todo el espesor de la mucosa. Las diferencias de uno o más grados fueron reexaminadas por ambos observadores, llegándose a un consenso final. El protocolo consideró las siguientes características de la mucosa gástrica: infiltrado polimorfonuclear (PMN, escala 0-3), presencia y grado de exocitosis PMN (0-3), infiltrado linfocitario (0-3), atrofia (0-3), metaplasia intestinal (0-3), lesión del epitelio de revestimiento superficial (0-3), actividad regenerativa (0-3) y presencia y cantidad de organismos del tipo H pylori (0-3). Por último, se realizó diagnóstico final de acuerdo a la clasificación de Sydney modificada, Houston 199522.

Estadística: El estudio de tendencia se realizó con prueba de suma de rangos de Wilcoxon, modificada por Cuzick (1985). La dependencia de variables nominales se efectuó con tabulaciones cruzadas (c2 con corrección de Yates o prueba exacta de Fisher). En todas las pruebas estadísticas se consideraron diferencias estadísticamente significativas con p <0,05. Para el estudio de la concordancia se utilizó variables kappa, en tablas de 2x2, que fluctúa entre 0 y 1. Si el valor es menor a 0,4 la concordancia se considera baja o discreta y si es mayor de 0,8 se estima casi perfecta.

Resultados

En el grupo completo, el promedio de edad fue 50,6±15,7 años (rango: 20-94), la relación hombre/mujer fue 0,37 y sólo tres casos tuvo uno o dos apellidos de origen mapuche (4%). En los individuos con infección por H pylori, el promedio de edad fue 52 años y en los no infectados el promedio de edad fue 45 (p=0,18).

En 82,8% (53/64) de los individuos se encontró positividad en el PCR específico para H pylori. Por otro lado, en 5/11 casos con PCR específico para H pylori negativo se encontró bacilos del tipo H pylori en los cortes histológicos, aunque en todos ellos con cantidad muy escasa (evidencia molecular + evidencia histológica= 91%). La correlación entre ambos métodos con variable kappa fue de 0,33, en el rango de concordancia baja o discreta.

La genotipificación del gen vacA fue s2/m2 (35,9%), s1/m1 (24,5%) y s1/m2 (7,6%). Los casos restantes fueron parcial o totalmente no tipificables (5 y 3 casos, respectivamente) o con amplificación de más de un alelo en la región m (9 casos). Sólo se encontró un caso s2/m1, correspondiente a uno de aquellos sin material suficiente para estudio histológico (no considerado en la correlación de genotipos con las lesiones histopatológicas). De acuerdo a la genotipificación de los genes vacA o iceA, el 20,8% (11/53) de los casos con PCR específico para H pylori positivo presentaron amplificación de más de una combinación de alelos, denotando la presencia de, al menos, dos cepas de H pylori en el material estudiado (vacA s1/m1-m2 o vacA s2/m1-m2 o iceA1/iceA2).

En la Figura 3 se muestra la relación existente entre las características genotípicas del gen vacA de las cepas de H pylori identificadas y la actividad inflamatoria aguda, según el infiltrado PMN de la lámina propia y en el epitelio de revestimiento (Figura 4a). No se encontró correlación estadísticamente significativa entre la presencia de los alelos s2, m1 y m2 y el grado de infiltración leucocitaria PMN (c2 con corrección de Yates, p=0,21, p=0,1 y p=0,44, respectivamente). En cambio, la presencia del alelo s1 del gen vacA sí se correlacionó positivamente con la intensidad del infiltrado PMN (c2 con corrección de Yates, p=0,01).



Figura 3. Barras que muestran en forma porcentual la intensidad del infiltrado polimorfonuclear neutrófilo (blanco: ausente; gris claro: leve; gris oscuro: moderado; negro: intenso) en relación a la presencia o ausencia de los alelos de las regiones señal (s1 o s2) y media (m1 o m2) del gen vacA, y la presencia o ausencia del gen cagA.



Figura 4. Microfotografías de gastritis crónica con aumento del infiltrado inflamatorio, daño epitelial y presencia de bacterias de tipo H pylori. A (arriba izquierda): gastritis crónica con aumento del infiltrado inflamatorio de lámina propia, compuesto por células plasmáticas, linfocitos y PMN, células que también se encuentran dentro del epitelio de cuellos glandulares, indicadas por flechas (hematoxilina y eosina, magnificación original 400x); B (arriba derecha): mucus superficial con abundantes bacterias curvas del tipo H pylori (giemsa modificado, magnificación original 1000x); C (abajo izquierda): foveola gástrica con epitelio de revestimiento cilíndrico simple con mucosecreción conservada, con núcleos de disposición basal y citoplasma apical vacuolado (hematoxilina y eosina, magnificación original 400x); D (abajo derecha): gastritis crónica con extenso daño del epitelio de revestimiento superficial y foveolar, con marcada disminución de la mucosecreción superficial (en comparación con figura C), irregularidad y agrandamiento nuclear, microerosiones y exocitosis PMN (hematoxilina y eosina, magnificación original 400x).

En la Figura 5 se muestra la asociación entre la presencia de los alelos de la región señal y media del gen vacA de las cepas de H pylori reconocidas y el daño del epitelio de revestimiento de la superficie mucosa y de las foveolas gástricas (Figura 4d). A diferencia del infiltrado inflamatorio PMN, el daño epitelial presentó correlación positiva y estadísticamente significativa con los alelos s1 y m1 (c2 con corrección de Yates, p=0,00002 y p=0,007, respectivamente). Además, la lesión del epitelio de revestimiento exhibió correlación ne gativa y estadísticamente significativa con los alelos s2 y m2 (c2 con corrección de Yates, p=0,002 y p=0,02, respectivamente).

El gen cagA se amplificó con PCR específico en el 49,1% (26/53) de los casos con infección por H pylori (evidencia molecular). La expresión encontrada del gen cagA se correlacionó en forma positiva y estadísticamente significativa con la presencia de los alelos s1 y m1 del gen vacA (c2 con corrección de Yates, p=0,000009 y p=0,01, respectivamente). Por lo mismo, la expresión del gen cagA se correlacionó negativa y estadísticamente significativa con la presencia de los alelos s2 y m2 del gen vacA (c2 con corrección de Yates, p=0,0001 y p=0,03, respectivamente). Finalmente, la presencia del gen cagA en las cepas de H pylori amplificadas con PCR específico se correlacionó en forma estadísticamente significativa con la intensidad del infiltrado PMN y la severidad del daño epitelial (Figuras 3 y 5, respectivamente); (c2 con corrección de Yates, p=0,04 y p=0,001, respectivamente).



Figura 5. Barras que muestran en forma porcentual la intensidad del daño epitelial en la mucosa gástrica (depleción de mucus, lesiones celulares degenerativas y microerosiones; blanco: ausente; gris claro: leve; gris oscuro: moderado; negro: intenso) en relación a la presencia o ausencia de los alelos de las regiones señal (s1 o s2) y media (m1 o m2) del gen vacA, y a la presencia o ausencia del gen cagA.

Los alelos del gen iceA fueron tipificables en 86,8% (46/53), con 15,1% (8/53) tipo iceA1, 60,4% (32/53) iceA2 y 11,3% (6/53) iceA1/iceA2. Los resultados de esta alelotipificación no se correlacionaron en forma estadísticamente significativa, con el grado de infiltración PMN ni con la intensidad del daño epitelial de la mucosa gástrica. Finalmente, la presencia del alelo iceA1 no se correlacionó con la presencia del gen cagA ni con formas específicas del gen vacA.

No se encontró relación entre la presencia del gen cagA o la alelotipificación de genes vacA e iceA con los cambios histopatológicos crónicos de la mucosa gástrica, tales como la presencia de metaplasia intestinal, la atrofia o la intensidad del infiltrado linfoide. Por último, el estudio de tendencia demostró una asociación estadísticamente significativa entre la cantidad de gérmenes y la presencia de los alelos s1 y m1 del gen vacA y con la presencia del gen cagA (prueba de suma de rangos de Wilcoxon modificada por Cuzick, probabilidad >|z|=0,02, 0,01 y 0,05, respectivamente).

Discusión

El porcentaje (83%) encontrado de infección por H pylori (evidencia molecular) es similar a otras publicaciones23,24 y comparable al 82% reportado por nosotros el año 2000 en Temuco, en una serie de 200 pacientes21. Además, el promedio de edad de los individuos infectados presentó una tendencia superior al de los no infectados con H pylori, sin diferencias significativas, pero similar a lo comunicado con anterioridad25.

La genotipificación de la infección por H pylori ha cobrado significancia, dada la asociación encontrada entre genotipos cagA+ o vacA s1/m1 con riesgo elevado de cáncer gástrico26,27 o úlcera péptica16,27-29, con riesgos 6 veces mayor en individuos cagA+ que en controles con infección por H pylori cagA-. Estas variables pueden llegar a tener considerable importancia en el tamizaje de poblaciones de mayor riesgo de cáncer gástrico, permitiendo seleccionar a grupos de pacientes con mayores posibilidades de desarrollar cáncer gástrico. En nuestros pacientes, la frecuencia de la infección cagA+ fue similar a la de los grupos controles (sin cáncer), por debajo de la frecuencia reportada en individuos con carcinoma gástrico, lo cual alcanza aproximadamente a 80%26.

La distribución de frecuencia de los genotipos de las cepas estudiadas fue similar a la reportada en otros estudios nacionales16,30, particularmente en la presencia del gen cagA y en la presencia de los subgenotipos s1 o m1 del gen vacA. Además, el hallazgo de un caso de genotipo s2/m1 en el gen vacA confirma la existencia, pero también la rareza, de este tipo de cepa de H pylori30.

En el gen vacA, la presencia de los alelos s1 y m1 de las regiones señal y media, respectivamente, se relacionó en forma directa con la intensidad del componente exudativo y alterativo de la gastritis. Además, la presencia de los alelos s2 y m2 se relacionó en forma inversa con este componente agudo, particularmente con la severidad del daño epitelial. Aunque en el ser humano no ha sido posible demostrar la capacidad lesiva de la toxina vacuolizante producida por el gen vacA, la asociación de los genotipos s1/m1 o s1/m2 con una mayor inflamación aguda de la mucosa gástrica, sustenta el concepto actual que es el genotipo del gen vacA lo determinante en la mayor producción de la proteína citotóxica vacuolizante lesiva7.

Similar condición fue encontrada en el gen cagA, particularmente en su asociación con cambios inflamatorios agudos de la mucosa gástrica. Además, si bien es cierto no hay una concordancia absoluta entre la presencia de este gen en las cepas de H pylori y la expresión de formas más patogénicas del gen vacA, el análisis estadístico sí apunta a que la cepas de H pylori estudiadas presentaron asociaciones significativas y coincidentes en su capacidad lesiva, con una particular agregación de cepas cagA+ y vacA s1/m1 o vacA s1/m27,31. Conviene hacer notar que el mecanismo para producir una mayor exocitosis PMN y daño epitelial consecutivo, probablemente, reside en la particular inducción de producción de IL-8 por cepas cagA+, la cual de por sí atrae PMN32.

En el grupo estudiado, el genotipo s2/m2 del gen vacA se encontró en un poco más de un tercio de los casos. La presencia de este genotipo constituye por sí mismo un factor protector, con gérmenes que más que parásitos estrictos, podrían catalogarse como comensales. Similar condición se aprecia en las cepas cagA-, las que también podrían ser visualizadas como comensales, particularmente si no existe asociación con cambios inflamatorios agudos en la mucosa gástrica1.

Examinado en forma recíproca, la presencia de cambios inflamatorios agudos moderados o severos en gastritis asociada a infección por H pylori, permite presumir la presencia de cepas de H pylori con mayor capacidad patogénica. Mientras no sea posible contar en forma rutinaria con la genotipificación de H pylori infectante, se podría permutar la determinación del genotipo bacteriano por la apreciación histopatológica de los cambios inflamatorios, considerando al infiltrado PMN y particularmente al daño epitelial. Estos hallazgos deberían servir para la definición de factores de riesgo en el estudio de individuos con gastritis, con variables de tipo morfológico y microbiológico, útil para la definición de pautas de tratamiento de erradicación de esta bacteria.

Desde un punto de vista biológico, la inflamación exudativa y alterativa se acompaña de daño epitelial, el cual se ha descrito como causa de aumento de la proliferación celular33, que condicionaría una mayor probabilidad de transformación neoplásica si esta alteración persiste por décadas. Por otro lado, desde un punto de vista epidemiológico también se ha descrito que determinados genotipos de H pylori implican mayor riesgo de cáncer gástrico34, lo cual también refuerza el concepto de que la genotipificación bacteriana debiera ser implementada en la práctica clínica.

Si bien es cierto nuestros resultados no encontraron correlación entre los tipos de H pylori infectantes y la inflamación crónica, existen otros trabajos que sí han encontrado tal correlación35. En este caso, es probable que factores confundentes hayan participado en la no demostración de esta asociación. Similar explicación encontramos para la ausencia de correlación entre la presencia del genotipo iceA1 y la inflamación aguda o crónica36. Para ambos efectos será necesario contar con un número mayor de casos y que suceda que éstos sean obtenidos de diferentes áreas geográficas, con distintas expresiones epidemiológicas de cáncer gástrico y de gastritis crónica.

La metodología empleada para amplificar el ADN de H pylori ofrece ventajas de simpleza y confiabilidad. Ambas condiciones podrían plantearse como el fundamento para lograr introducir la genotipificación de H pylori en la práctica clínica de rutina, reduciendo el costo a rangos de accesibilidad. Además, el estudiar directamente el material de biopsia permitió demostrar que 1 de cada 5 casos infectados con H pylori poseen, a lo menos, dos cepas distintas de la bacteria, lo cual proporcionaría un mejor valor predictivo al método si lo que se desea demostrar son cepas de perfil lesivo.

Existe escasa información de seguimiento de individuos infectados con H pylori y dispepsia no ulcerosa o seudo ulcerosa. En un estudio de 2 años de duración, se demostró que 8% de personas con dispepsia no ulcerosa desarrollaron úlcera péptica, siendo la infección por H pylori un factor de riesgo independiente de la edad del paciente y del uso de antiinflamatorios no esteroidales37. Además, otro estudio demostró que 2,9% de individuos con infección por H pylori desarrolló cáncer gástrico, en un promedio de seguimiento de 7,8 años38. Estos antecedentes confirman la importancia que podría adquirir el estudio cuidadoso de individuos con infección por H pylori, independientemente que tengan o no úlcera péptica, carcinoma gástrico o linfoma gástrico, dado que un porcentaje significativo podría desarrollar alguna patología gástrica mayor. En tal sentido, la realización de endoscopias de control, la obtención de la información genotípica del germen y la aparición de cambios inflamatorios agudos manifiestos en la histología gástrica podrían constituir elementos de juicio valiosos en el proceso de decisión clínica y terapéutica de individuos con infección por H pylori.

Referencias

1. Clearfield HR. Helicobacter pylori: aggressor or innocent bystander? Med Clin North Am 1991; 75: 815-23.         [ Links ]

2. Labigne A, de Reuse H. Determinants of Helicobacter pylori pathogenicity. Infect Agents Dis 1996; 5: 191-202.         [ Links ]

3. Suerbaum S, Michetti P. Helicobacter pylori infection. N Engl J Med 2002; 347: 1175-86.         [ Links ]

4. Correa P. Helicobacter pylori as a pathogen and carcinogen. J Physiol Pharmacol 1997; 48 Suppl 4: 19-24.         [ Links ]

5 Pareti G, Cerletti C, Gaetano G. How old is Helicobacter pylori? Lancet 2002; 359: 1700-1.         [ Links ]

6. Marshall BJ. Campylobacter pyloridis and gastritis. J Infect Dis 1986; 153: 650-7.         [ Links ]

7 Atherton JC, Cao P, Peek RM Jr, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem 1995; 270: 17771-7.         [ Links ]

8. Fox JG, Correa P, Taylor NS, Thompson N, Fontham E, Janney F et al. High prevalence and persistence of cytotoxin-positive Helicobacter pylori strains in a population with high prevalence of atrophic gastritis. Am J Gastroenterol 1992; 87: 1554-60.         [ Links ]

9. Peek RM Jr, Thompson SA, Donahue JP, Tham KT, Atherton JC, Blaser MJ et al. Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome. Proc Assoc Am Physicians 1998; 110: 531-44.         [ Links ]

10. Crabtree JE. Gastric mucosal inflammatory responses to Helicobacter pylori. Aliment Pharmacol Ther 1996; 10 Suppl 1: 29-37.         [ Links ]

11. Peek RM Jr, Miller GG, Tham KT, Pérez-Pérez GI, Zhao X, Atherton JC et al. Heightened inflammatory response and cytokine expression in vivo to cagA+ Helicobacter pylori strains [see comments]. Lab Invest 1995; 73: 760-70.         [ Links ]

12. Atherton JC, Peek RM Jr, Tham KT, Cover TL, Blaser MJ. Clinical and pathological importance of heterogeneity in vacA, the vacuolating cytotoxin gene of Helicobacter pylori. Gastroenterology 1997; 112: 92-9.         [ Links ]

13. Han SR, Schneider T, Loos M, Bhakdi S, Maeurer MJ. One step polymerase chain reaction based typing of Helicobacter pylori vacA gene: association with gastric histopathology. Med Microbiol Immunol (Berl) 1999; 188: 131-8.         [ Links ]

14. Nogueira C, Figueiredo C, Carneiro F, Gomes AT, Barreira R, Figueira P et al. Helicobacter pylori genotypes may determine gastric histopathology. Am J Pathol 2001; 158: 647-54.         [ Links ]

15. Ashour AA, Magalhaes PP, Mendes EN, Collares GB, de Gusmao VR, Queiroz DM et al. Distribution of vacA genotypes in Helicobacter pylori strains isolated from Brazilian adult patients with gastritis, duodenal ulcer or gastric carcinoma. FEMS Immunol Med Microbiol 2002; 33: 173-8.         [ Links ]

16. Faúndez G, Troncoso M, Figueroa G. cagA and vacA in strains of Helicobacter pylori from ulcer and non-ulcerative dyspepsia patients. BMC Gastroenterol 2002; 2: 20.         [ Links ]

17. Figueiredo C, Machado JC, Pharoah P, Seruca R, Sousa S, Carvalho R et al. Helicobacter pylori and interleukin 1 genotyping: an opportunity to identify high risk individuals for gastric carcinoma. J Natl Cancer Inst 2002; 94: 1680-7.         [ Links ]

18. Graham DY, Yamaoka Y. Disease-specific Helicobacter pylori virulence factors: the unfulfilled promise. Helicobacter 2000; 5 Suppl 1: 3-9.         [ Links ]

19. Van Zwet AA, Thijs JC, Kooistra SA, Schirm J, Snijder JAM. Sensitivity of culture compared with that of polymerase chain reaction for detection of Helicobacter pylori from antral biopsy samples. J Clinical Microbiol 1993; 31: 1918-20.         [ Links ]

20. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. 1985. Biotechnology 1992; 24: 476-80.         [ Links ]

21. Araya JC, Villaseca MA, Roa I, Roa JC. Helicobacter pylori and chronic gastritis: relationship between infection and inflammatory activity in a high risk population for gastric cancer. Rev Méd Chile 2000; 128: 259-65.         [ Links ]

22. Dixon MF, Genta RM, Yardley JH, Correa P. Classification and grading of gastritis. The updated Sydney System. Am J Surg Pathol 1996; 20: 1161-81.         [ Links ]

23. Fernández HJ, Ibarra H, León J, Toledo C. Isolation of Campylobacter pylori from gastric biopsies in people from the south of Chile. Rev Méd Chile 1989; 117: 1180-1.         [ Links ]

24. Figueroa G, Acuña R, Troncoso M, Portell D, Toledo S, Valenzuela J. Helicobacter pylori infection in Chile. Clin Infect Dis 1997; 25: 983-9.         [ Links ]

25. Dooley CP, Cohen H, Fitzgibbons PL, Bauer M, Appleman MD, Pérez-Pérez GI et al. Prevalence of Helicobacter pylori infection and histologic gastritis in asymptomatic persons. N Engl J Med 1989; 321: 1562-6.         [ Links ]

26. Parsonnet J, Friedman GD, Orentreich N, Vogelman H. Risk for gastric cancer in people with CagA positive or CagA negative Helicobacter pylori infection. Gut 1997; 40: 297-301.         [ Links ]

27. Arents NL, Van Zwet AA, Thijs JC, Kooistra-Smid AM, van Slochteren KR, Degener JE et al. The importance of vacA, cagA, and iceA genotypes of Helicobacter pylori infection in peptic ulcer disease and gastroesophageal reflux disease. Am J Gastroenterol 2001; 96: 2603-8.         [ Links ]

28. Choi KM, Lim WJ, Park JK, Hwang SY. Presumptive mechanisms of peptic ulceration by Helicobacter pylori VacA involving mucoprotease and CagA. Mol Cells 2001; 11: 312-20.         [ Links ]

29. Gunn MC, Stephens JC, Stewart JA, Rathbone BJ, West KP. The significance of cagA and vacA subtypes of Helicobacter pylori in the pathogenesis of inflammation and peptic ulceration. J Clin Pathol 1998; 51: 761-4.         [ Links ]

30. Martínez A, González C, Kawaguchi F, Montoya R, Corvalán A, Madariaga J et al. Helicobacter pylori: cagA analysis and vacA genotyping in Chile. Detection of a s2/m1 strain. Rev Méd Chile 2001; 129: 1147-53.         [ Links ]

31. Nogueira C, Figueiredo C, Carneiro F, Gomes AT, Barreira R, Figueira P et al. Helicobacter pylori genotypes may determine gastric histopathology. Am J Pathol 2001; 158: 647-54.        [ Links ]

32. Yamaoka Y, Kita M, Kodama T, Sawai N, Kashima K, Imanishi J. Induction of various cytokines and development of severe mucosal inflammation by cagA gene positive Helicobacter pylori strains [see comments]. Gut 1997; 41: 442-51.         [ Links ]

33. Hoshi T, Sasano H, Kato K, Ohara S, Shimosegawa T, Toyota T et al. Cell damage and proliferation in human gastric mucosa infected by Helicobacter pylori, a comparison before and after H pylori eradication in non-atrophic gastritis. Hum Pathol 1999; 30: 1412-7.         [ Links ]

34. Asghar RJ, Parsonnet J. Helicobacter pylori and risk for gastric adenocarcinoma. Semin Gastrointest Dis 2001; 12: 203-8.         [ Links ]

35. Kuipers EJ, Pérez-Pérez GI, Meuwissen SG, Blaser MJ. Helicobacter pylori and atrophic gastritis: importance of the cagA status. J Natl Cancer Inst 1995; 87: 1777-80.        [ Links ]

36. van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, De Boer W et al. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 1998; 115: 58-66.         [ Links ]

37. Hsu PI, Lai KH, Lo GH, Tseng HH, Lo CC, Chen HC et al. Risk factors for ulcer development in patients with non ulcer dyspepsia: a prospective two years follow up study of 209 patients. Gut 2002; 51: 15-20.         [ Links ]

38. Uemura N, Okamoto S, Yamamoto S, Matsumura N, Yamaguchi S, Yamakido M et al. Helicobacter pylori infection and the development of gastric cancer. N Engl J Med 2001; 345: 784-9.         [ Links ]

Correspondencia a: Juan Carlos Araya O. Casilla 54-D, Temuco, Chile. Fono: 56-45-296528; Fax: 56-45-216273. E mail: jcaraya@ufro.cl.

Recibido el 10 de marzo, 2004. Aceptado en versión corregida el 17 de agosto, 2004.

Trabajo financiado por proyectos FONDECYT # 1020283 y DIUFRO # 2029.

 

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons