SciELO - Scientific Electronic Library Online

 
vol.147 número1Leucemia de células plasmáticas primaria: experiencia en un hospital público chilenoRegistro de paro cardiorrespiratorio perioperatorio en un hospital universitario en el período 2006-2017 índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Revista médica de Chile

versión impresa ISSN 0034-9887

Rev. méd. Chile vol.147 no.1 Santiago  2019

http://dx.doi.org/10.4067/S0034-98872019000100024 

Artículo de Investigación

Caracterización de cepas clínicas y ambientales de Salmonella enterica subsp. enterica serovar Heidelberg aisladas en Chile

Characterization of Salmonella Heidelberg strains isolated in Chile

Carmen Aravena1  6  ab

Bárbara Valencia2  d

Andrea Villegas2  d

Mauricio Ortega1  e

Alda Fernández R.3  c

Pamela Araya R.3  a

Aníbal Saavedra2  4  c

Rosa  Del Campo5  b

1Escuela de Medicina, Campus San Felipe, Universidad de Valparaíso. San Felipe, Chile

2Escuela de Tecnología Médica, Campus San Felipe, Universidad de Valparaíso. San Felipe, Chile

3Laboratorio de Bacteriología, Instituto de Salud Pública de Chile. Santiago, Chile

4Laboratorio de Microbiología Clínica Río Blanco. Los Andes, Chile

5Laboratorio de Bacteriología, Instituto Ramón y Cajal de Investigación Sanitaria. Madrid, España

6Centro Interdisciplinario de Investigación en Salud Territorial del Valle de Aconcagua, Universidad de Valparaíso. San Felipe, Chile

ABSTRACT

Background:

Salmonella Heidelberg (S. Heidelberg) causes gastroenteritis and sometimes bacteremia and endocarditis. In other countries, this serovar has multidrug resistance including extended-spectrum β-lactamases (ESBLs) and AmpC (β-lactamases (AmpC), associated with the blaCMY-2 gene. In Chile, an outbreak by S. Heidelberg occurred in 2011, the phenotypic and genetic characteristics of Chilean strains are unknown.

Aim:

To determine the antimicrobial susceptibility, presence of plasmids and virulence factor genes in S. Heidelberg strains isolated in Chile over the period 2006-2011.

Material and Methods:

In sixty-one S. Heidelberg clinical and environmental strains collected by the Public Health Institute in Chile during 2006-2011, antimicrobial susceptibility, plasmids and virulence factor genes (invA, sifA, pefA, agfA, lpfA and, stkD) were studied.

Results:

S. Heidelberg had a high susceptibility to sulfamethoxazole-trimethoprim, gentamicin, ceftriaxone, ceftiofur, chloramphenicol, amoxicillin-clavulanic acid and ampicillin. However, 52% had decreased susceptibility to ciprofloxacin and 33% resistance to tetracycline. ESBLs were detected in three strains isolated from blood cultures, environment and human feces. The latter strain was positive for AmpC and blaCMY-2 gene. Fifty three of 61 strains showed one to seven plasmids of 0.8 to approximately 30 kb. Most plasmids were small with sizes between 0.8 and 2 kb. All isolates were positive for all genes except pefA.

Conclusions:

S. Heidelberg isolated from Chilean samples was susceptible to first-line antimicrobials, except tetracycline and ciprofloxacin. The emergence of strains with ESBLs and AmpC should be a warning. The strains were homogeneous for virulence genes, but heterogeneous in their plasmids.

Key words: Drug Resistance; Gastroenteritis; Plasmids; Salmonella enterica

Salmonella enterica subsp. enterica serovar Heidelberg, que por convención y simplicidad nombraremos como S. Heidelberg, es uno de los serovares de Salmonella más frecuentemente aislados en casos de gastroenteritis en Canadá y Estados Unidos de Norteamérica1,2. Carnes de aves de corral y huevos la principal fuente de transmisión a humanos3,4. S. Heidelberg ha mostrado ser muy invasiva causando septicemia y endocarditis57. En Brasil, África y en Norteamérica se han descrito cepas de S. Heidelberg multirresistentes a los antimicrobianos provenientes de carnes de ave, cerdos y huevos1,4,8,9, lo que se atribuye al uso de ceftiofur y también de florfenicol en la producción animal4,5,10. Particularmente, la resistencia a ceftiofur, una cefalosporina de tercera generación, se asocia a la resistencia múltiple a drogas y a la presencia del gen blaCMY-2 que codificaría para una β-lactamasa plasmidial tipo AmpC, presente en enterobacterias y muy prevalente en Escherichia coli y Salmonella4,9,1114.

En S. Heidelberg, variaciones en la capacidad de invasión y colonización de las cepas se han asociado a diferencias en la presencia de genes de virulencia (invA, agfA y lpfA) y en el patrón de electroforesis en gel de campo pulsado6,15.

En Chile, Salmonella Enteritidis es el serovar causante de gastroenteritis más frecuente en los últimos 20 años16,17; sin embargo, se observó un incremento de S. Heidelberg en 2011 respecto a los años 2006-2010 (Fernández A et al. 2011, X Jornadas Científicas, Instituto de Salud Pública de Chile). Esto se puede atribuir al surgimiento de nuevas variantes genéticas con mayor capacidad patógena, aunque actualmente se desconocen las características fenotípicas y genotípicas de las cepas de S. Heidelberg que circulan en nuestro país. Por ello, el objetivo de este estudio fue caracterizar la susceptibilidad antimicrobiana, la presencia de plásmidos, genes de resistencia y de virulencia de cepas de S. Heidelberg aisladas en Chile en el período mencionado.

Material y Métodos

Cepas bacterianas

Sesenta y un aislamientos (32 clínicos y 29 ambientales o no humanos) de S. Heidelberg de diferentes partes de Chile y remitidos al Instituto de Salud Pública de Chile (ISP Chile) entre los años 2006 y 2011, se seleccionaron aleatoriamente entre 9 y 10 aislamientos por año, considerando ambos orígenes (Tabla 1). S. Heidelberg se identificó por técnicas microbiológicas convencionales y por serología según métodos estándar en ISP Chile18. Para diferentes pruebas se usaron cepas controles: E. coli ATCC 25922 y Salmonella Typhimurium LT2.

Tabla 1 Cepas de S. Heidelberg estudiadas, código de identificación de cada cepa, año de recolección y origen (n = 61) 

Cepa Año Origen Cepa Año origen
SH01 2006 Clínico SH32 2009 Pavo
SH02 2006 Clínico SH33 2009 Clínico
SH03 2006 Animal n/e SH34 2009 Superficie n/e
SH04 2006 Clínico SH35 2010 Pollo
SH05 2006 No humano n/e SH36 2010 Cerdo
SH06 2006 Clínico SH37 2010 Clínico
SH07 2006 Pavo crudo SH38 2010 Aves n/e
SH08 2006 Clínico SH39 2010 Aves n/e
SH09 2006 Agua cloacas SH40 2010 Aves n/e
SH10 2007 Clínico SH41 2010 Pollo
SH11 2007 Clínico SH42 2010 Pollo
SH12 2007 Clínico SH43 2010 Clínico
SH13 2007 Pavo crudo SH44 2010 Carne de pavo
SH14 2007 Ensalada surtida SH45 2010 Clínico
SH15 2007 Clínico SH46 2010 Clínico
SH16 2007 No humano n/e SH47 2010 Clínico
SH17 2007 Clínico SH48 2010 Pollo
SH18 2008 Clínico SH49 2010 Ave
SH19 2008 Clínico SH50 2010 Pavo
SH20 2008 Clínico SH51 2010 Clínico
SH21 2008 Carne pollo SH52 2011 Clínico
SH22 2008 Jamón de cerdo SH53 2011 No humano n/e
SH23 2008 Pollo SH54 2011 Clínico
SH24 2008 Alimento n/e SH55 2011 Clínico
SH25 2008 Clínico SH56 2011 Clínico
SH26 2009 Pavo cocido SH57 2011 Clínico
SH27 2009 Clínico SH58 2011 Clínico
SH28 2009 Clínico SH59 2011 Clínico
SH29 2009 Clínico SH60 2011 Pollo
SH30 2009 Ciegos de rata SH61 2011 Ave
SH 31 2009 Clínico

n/e= no especificado; clínico= cepas obtenidas desde pacientes humanos.

Susceptibilidad antimicrobiana

Se realizó por método de difusión en agar con sensidiscos19. Se utilizó agar Mueller Hinton (Valtek Diagnostics, Chile) y sensidiscos de: ceftiofur (30 μg), sulfametoxazol-trimetoprim (25 μg) y cloranfenicol (30 μg) (Oxoid, Reino Unido). Para amoxicilina-ácido clavulánico, tetraciclina, gentamicina, ciprofloxacino, ampicilina y ceftriaxona se determinó la concentración inhibitoria mínima (CIM) usando M.I.C. Evaluator™ (Oxoid, Reino Unido). Ambos métodos se realizaron en condiciones estándar y por duplicado para cada aislamiento, la interpretación fue según los criterios del Clinical and Laboratory Standards Institute20. BLEE y AmpC se determinaron mediante test de inhibición con sensidiscos utilizando ceftazidima (30 μg), ceftazidima-clavulanato (30/10 μg) y cefotaxima (30 μg) y cefotaxima-clavulanato (30/10 μg) utilizando los criterios para K. pneumoniae19.

Extracción de plásmidos

Una o 2 colonias de S. Heidelberg crecidas en agar Salmonella-Shigella (HiMedia, India) se cultivaron en 10 ml de caldo Luria Bertani (Omega Bio-Tek, USA) a 37 °C por 18 h, para obtener luego el ADN plasmídico con kit de extracción E.Z.N.A.® Plasmid Mini Kit II (Omega Bio-Tek, USA). El ADN se cuantificó por fotometría y 0,5 μg de ADN plasmidial se mezclaron con tampón de carga ADN 6X (Thermo Scientific) incubando a 100 °C por 3 min para evitar la formación concatámeros. Los plásmidos fueron separados por electroforesis en gel de agarosa al 0,7%, según Takahashi y Nagano, 198421. El ADN teñido con Gel Red (Biotium, USA) fue visualizado en transiluminador UV. El tamaño de cada plásmido se determinó por comparación con fragmentos patrones de fago Lambda DNA/HindIII y 100 bp DNA Ladder (Thermo Ficher Scientific, Inc.).

Extracción de ADN bacteriano

Se realizó según Fadl et al., 199522. El ADN bacteriano se cuantificó y visualizó en las mismas condiciones que los plásmidos.

Detección de genes

Los genes agfA, lpfA, sifA, stkD, pefA, invA y el gen blaCMY-2 fueron detectados por reacción en cadena de la polimerasa (RCP) de punto final, según condiciones indicadas en la Tabla 2. La secuencia nucleotídica parcial de los genes se obtuvo desde el producto de RCP usando como templado ADN de la cepa SH06. La secuenciación se realizó en secuenciador automático ABI PRISM 310 Genetic Analyzer (Applied Biosystem) según Sanger et al., 197728. Las secuencias fueron ingresadas en GenBank®: blaCMY-2 (KP340125), invA (KX267824), agfA (KY564364), sifA (KY564365) y stkD (KY564366).

Tabla 2 Partidores utilizados para la detección de genes de virulencia en S. Heidelberg. Se indica el tamaño de la región amplificada, la temperatura utilizada en la etapa de annealing y la publicación de donde se obtuvo la secuencia de los partidores 

Gen Partidores Tamaño
pb
T° annaeling Referencia
agfA F: tccacaatggggcggcggcg
R: cctgacgcaccattacgctg
350 54 °C (23)
bla CMY-2 F: gacagcctctttctccaca
R: tggaacgaaggctacgta
1.000 50 °C (24)
lpfA F: ctttcgctgctgaatctggt
R: cagtgttaacagaaaccagt
250 54 °C (25)
pefA F: ttccattattgcactgggtg
R: aagccactgcgaaagatgcc
496 62 °C (26)
sifA F: tttgccgaacgcgcccccacacg
R: gttgccttttcttgcgctttccacccatct
449 66,5 °C (27)
invA F: cgatagcctggcggtgggtttt
R: gcggggatctgggcgacaag
411 62 °C Diseño propio
stkD F: cccctgtggtagccgaattt
R: gcttgccgctaactccacta
467 60 °C Diseño propio

F = forward; R = reverse; agfA = gen de operón fimbria tipo 1; bIaCMY-2 = gen de β-lactamasa tipo AmpC; lpfA = gen de fimbria largo polar; pefA = gen adhesina de fimbria codificado en plásmido; sifA = gen de factor que favorece la multiplicación bacteriana en macrófago; invA = gen de factor de invasión epitelial; stkD = gen fimbrial putativo; pb = pares de bases; T° = temperatura; °C = grados Celsius.

Conjugación bacteriana

Para la conjugación se usaron como dadoras las cepas de S. Heidelberg resistentes a ceftriaxona y a ceftiofur y como cepa receptora una E. coli K-12 (Bio-Rad, USA) resistente a rifampicina (100 μg/mL), según protocolo de Phornphisutthimas et al. 200729.

Análisis estadístico

Se agruparon las cepas de S. Heidelberg según la presencia de plásmidos de tamaño similar por análisis de clúster de tipo jerárquico, con software estadístico STATA 11 (StataCorp) para Windows (Microsoft Corporation).

Electroforesis en gel de campo pulsado (EGCP)

Se realizó EGCP a las cepas de S. Heidelberg BLEE positivas, según el protocolo de CDC Pulse Net (http://www.cdc.gov/pulsenet/pathogens/index.html, último acceso el 9 de julio de 2018) usando la enzima XbaI.

Resultados

Susceptibilidad a los antimicrobianos

Los aislamientos de S. Heidelberg clínicos y ambientales mostraron una susceptibilidad mayor al 90% en los antimicrobianos probados excepto para tetraciclina y ciprofloxacino (Tabla 3). Cepas de todos los años mostraron resistencia a tetraciclina con mayor proporción en cepas clínicas que en ambientales. Con ciprofloxacino, S. Heidelberg no mostró resistencia, pero 52,5% de las cepas tuvo susceptibilidad intermedia (CIM entre 0,12-0,5 μg/ml), disminuyendo la susceptibilidad a este antimicrobiano. De todos los aislamientos estudiados, 11 (18%) fueron susceptibles a todos los antimicrobianos probados y 18 (29,5%) mostraron resistencia a 1 o más antimicrobianos (12 clínicas y 6 ambientales), el resto fueron cepas con susceptibilidad intermedia a ciprofloxacino (resultados no se muestran). Dos cepas de S. Heidelberg del año 2006, una ambiental (SH05) y otra de deposiciones (SH06), más un aislado de hemocultivo (SH 52) año 2011, mostraron resistencia simultánea a ceftiofur, ampicilina, ceftriaxona y a amoxicilina-ácido clavulánico. Todas ellas fueron positivas para BLEE, aunque solo la cepa SH06 fue positiva para AmpC y para el gen bla CMY-2, además, esta cepa transfirió la resistencia a amoxicilina-ácido clavulánico a E. coli K-12 por conjugación de un plásmido de cerca de 30 kb, como el detectado en la cepa dadora. El análisis por campo pulsado de las cepas BLEE positivas mostró que son clones estrechamente relacionados (los resultados no se muestran).

Tabla 3 Susceptibilidad antimicrobiana de S. Heidelberg. Se muestra el porcentaje de la susceptibilidad total de todas las cepas (n = 61) y la susceptibilidad según el origen de las cepas, aislamientos clínicos (n = 32) y ambientales (n = 29) 

Antimicrobiano Origen % S % I % R % S total
Ampicilina Clínico 90,6 0 9,4 91,8
Ambiental 93,1 0 6,9
Amoxicilina/ácido clavulánico Clínico 93,8 0 6,3 93,4
Ambiental 93,1 0 6,9
Ceftriaxona Clínico 93,8 0 6,3 95,1
Ambiental 96,6 0 3,4
Ceftiofur Clínico 93,8 0 6,3 95,1
Ambiental 96,6 0 3,4
Gentamicina Clínico 100 0 0 100
Ambiental 100 0 0
Tetraciclina Clínico 50,0 18,8 31,3 50,8
Ambiental 51,7 34,5 13,8
Cloranfenicol Clínico 96,9 3,1 0 95,1
Ambiental 93,1 6,9 0
Ciprofloxacino Clínico 71,9 28,1 0 47,5
Ambiental 20,7 79, 3 0
Sulfametoxazol-Trimetroprim Clínico 100 0 0 100
Ambiental 100 0 0

% = porcetaje; S = susceptibilidad; I = Susceptibilidad intermedia; R = resistencia y S total = como susceptibilidad de todas las cepas.

Plásmidos en S. Heidelberg

Cincuenta y tres cepas (87%) mostraron desde uno a siete plásmidos, con tamaños desde 0,8 hasta cerca de 30 kb, el resto, 7 aislamientos, no mostraron plásmidos. El análisis de clúster de los plásmidos de S. Heidelberg mostró que hay perfiles que se repiten en más de un aislado (grupos comunes), pero, además, hay una gran variabilidad respecto a los plásmidos presentes en cada cepa. Se obtuvieron once grupos comunes (C1-C11) y 16 únicos (S1-S16) (Tabla 4). El grupo C1, con cepas mayoritariamente clínicas que mostraron dos pequeños plásmidos, y C2 correspondería a cepas en donde no se detectaron plásmidos. En C3, las cepas tenían tres plásmidos, un plásmido adicional de 1,4 kb respecto al grupo C1 compuesto por cepas de años anteriores. Similar observación al comparar C3 y C5 donde el plásmido adicional es de 1 kb. En general, el número de plásmidos aumentó a medida que el año de recolección era más reciente, de cero a 2 plásmidos por cepa entre 2006-2007 y de 2-5 plásmidos entre el 2010-2011 (Tabla 4). La cepa SH35, con susceptibilidad intermedia a tetraciclina y a ciprofloxacino, mostró 7 plásmidos entre 0,8 y 4 kb (Tabla 4, S16). Este estudio evidenció que plásmidos de menos de 2 kb son frecuentes en S. Heidelberg y solo ocho cepas mostraron un plásmido de 30 kb que estaría como único plásmido o junto a otros pequeños plásmidos.

Tabla 4 Agrupamiento de cepas de S. Heidelberg según presencia de plásmidos. Para cada grupo se indica el tamaño de los plásmidos presentes o ausencia de ellos, el número de cepas que muestran la característica, el año y su origen (n = 61) 

Grupo Tamaño plásmidos (kb) n de cepas Año y origen de las cepas
C1 0,8 y 1,3 9 2006 (1 clin.), 2007 (3 clin.), 2008 (2 amb. y 1 clin.), 2009 (1 clin.), 2010 (1 clin.)
C2 Sin plásmidos 7 2006-2008 (2 ambientales y 5 clínicas)
C3 0,8, 1,3 y 1,4, 6 2010 (4 amb. y 1 clin.), 2011 (1 clin.)
C4 1,7 5 Todas ambientales: 2006 (1), 2007 (2), 2009 (1), 2010 (1).
C5 0,8, 1, 1,3 y 1,4 4 2010 (1 ambiental) y 2011 (2 clin. y 1 amb.)
C6 1,7 y ≈30 4 Todas ambientales 2007 (1), 2009 (3)
C7 0,8, 1,3 y 2,3 2 2008 y 2009 origen clínico
C8 0,8, 1 y 1,3 2 2010 clínica
C9 0,8 2 2007 y 2009 clínicas
C10 0,8, 1,3 y 2 2 2009 clínica
C11 0,8, 1,3, 1,4, 1,7 y 2 2 2010 (ambiental) y 2011 (clínica)
S1 0,8 y 1,4 1 2010 clínica
S2 0,8, 1,3, 1,7 y 2 1 2010 ambiental
S3 0,8, 1,0, 1,3 y 2 1 2008 ambiental
S4 1,3, 1,4 y 2,0 1 2010 clínica
S5 0,8, 0,9, 1,3, 1,4 y 1,7 1 2010 ambiental
S6 ≈30 1 2006 clínica
S7 1,4 y ≈30 1 2006 ambiental
S8 4 y 1,4 1 2010 ambiental
S9 2,3 y 3,3 1 2008 clínica
S10 1,3 y 2,2 1 2006 ambiental
S 11 1,3, 1,7, 2,5 y 30 1 2011 clínica
S12 1,2, 1,7, 3,3, y 30 1 2011 ambiental
S13 0,8, 1 y 2 1 2011 clínica
S14 1 y 2 1 2011 ambiental
S15 0,8 y 1,7 1 2011 clínica
S16 0,8, 1, 1,3, 1,4, 1,7, 2,5 y 4 1 2010 ambiental

C = grupo común con más de una cepa que comparten una característica; S = single o único que indica que solo una cepa tuvo la característica; kb = unidad de tamaño de los plásmidos en kilo pares de bases; clin. = clínica y amb. = ambiental, refiriéndose a cepas de procedencia no humano cuyo origen se especificó en la Tabla 1.

Presencia de genes de virulencia

Todas las cepas S. Heidelberg fueron positivas para los genes invA, sifA, stkD, agfA y lpfA, mientras que pefA no fue detectado en ningún aislamiento.

Discusión

Es importante estudiar las bacterias patógenas a nivel local para monitorear la aparición de clones virulentos y caracterizar las cepas circulantes30, además, es conocido que la susceptibilidad antimicrobiana de Salmonella enterica varía según su serovar, lugar geográfico, año de colección y origen4. En S. Heidelberg se ha reportado alta resistencia antimicrobiana en aislados de carnes de pavo, pollo y cerdo en Estados Unidos de Norteamérica, 66% de los aislados fue resistente a un antimicrobiano y 16% resistente hasta a cinco antimicrobianos, y en Turquía, 41% fue resistente a uno o más antimicrobianos4,31. Comparado con nuestro estudio en cepas ambientales (75% de procedencia animal), la resistencia a uno o más antimicrobianos fue baja (20,7%) e inclusive menor que la reportada en países vecinos como Argentina (27%) y Brasil (29%)6,32. Sin embargo, cepas clínicas mostraron un porcentaje superior (37,5%), atribuible principalmente a la resistencia a tetraciclina. En las cepas chilenas de S. Heidelberg, la baja susceptibilidad a tetraciclina se debió a la resistencia y susceptibilidad intermedia, lo que concuerda con otros estudios en S. enterica de diferentes orígenes aisladas en Chile (33, Prat S, et al., 2011, X Jornadas Científicas, ISP Chile). Estudios en Argentina de aislamientos animales de S. enterica y S. Heidelberg de origen animal y clínico mostraron resultados similares para tetraciclina4,32,34.

Más de la mitad de las cepas de S. Heidelberg del presente estudio mostraron susceptibilidad disminuida o intermedia a ciprofloxacino, lo que se ha descrito previamente en S. enterica35. El fenotipo resistente a ciprofloxacino se atribuye a mutaciones en el gen gyrA en los codones 83 u 87, sumado a la sobreexpresión de los genes mar A y soxS, reguladores de bombas de eflujo35,36. Los resultados sugieren que las cepas chilenas aún no presentan estas características, sin embargo, el uso indiscriminado de estos antimicrobianos podría favorecer la aparición de resistencia a las fluoroquinolonas.

La resistencia bacteriana se atribuye al uso y abuso de los antimicrobianos en humanos y animales en forma terapéutica, subterapéutica, profilaxis y como promotor del crecimiento37,38. Estudios de brote por S. Heidelberg atribuidos al consumo de carnes de aves de corral en Estados Unidos de Norteamérica, muestran multirresistencia, con un patrón de resistencia a gentamicina, ampicilina, tetraciclina y estreptomicina2 y otro patrón con combinaciones de resistencia a gentamicina, ampicilina, tetraciclina, cloranfenicol, kanamicina, estreptomicina y sulfametoxazol-trimetropin en 35% de los aislamientos clínicos39. En S. Heidelberg de origen chileno, solo una cepa de deposiciones (SH06) mostró multirresistencia a ampicilina, ceftriaxona, amoxicilina-ácido clavulánico, ceftiofur y tetraciclina, además, todas las cepas estudiadas por nosotros fueron susceptibles a gentamicina y a sulfametoxazol-trimetropin y no resistentes a cloranfenicol.

En Salmonella enterica subsp. enterica serovar Thyphimurium y en los serovares Heidelberg y Newport la resistencia a ceftiofur se relaciona con la resistencia a ceftriaxona, que puede deberse a una β-lactamasa del tipo AmpC plasmidial que presenta el gen blaCMY-2 y que se puede transferir por conjugación13,38. En nuestro estudio, cepas resistentes a ceftriaxona y a ceftiofur fueron BLEE positivas, pero solo la cepa SH06 (2006) fue positiva para AmpC y blaCMY-2. S. Heidelberg con estas características se han reportado en distintas partes del mundo4,11,14,33,40. En nuestro estudio, el análisis por EGCP de las cepas BLEE positivas mostró que existe entre ellas una estrecha relación clonal, es decir, provienen de un mismo clon de S. Heidelberg y, además, este clon está circulando en el ambiente (cepa SH05), causando infecciones intestinales (cepa SH06) e infecciones invasivas (cepa SH52), al menos el período de este estudio. Aunque cabe mencionar que a través del análisis de plásmidos y el antibiotipo fue posible establecer diferencias entre estas cepas.

Los resultados obtenidos por nosotros coinciden con reportes de plásmidos en S. Heidelberg de tamaños menores a 2 y hasta 7 kb y de 34 kb31,34,40. También, un plásmido de 3,3 kb en S. Heidelberg de origen clínico (2008) y otro ambiental (2011) concuerdan con el tamaño de un plásmido que codificaría para funciones de movilidad plasmídica en S. Heidelberg2,30,40. En nuestro estudio, ocho aislados mostraron plásmidos de 30 kb y uno de estos fue positivo para AmpC y el gen blaCMY-2, coincidente con plásmidos de tamaño similar descritos en S. Heidelberg37,40. Aunque debemos considerar que los plásmidos, a pesar de coincidir en tamaño, no significa que sean idénticos. También en S. Heidelberg se han descrito plásmidos de 40 y hasta 150 kb31,34,40, incluyendo algunos que codifican para P-lactamasas tipo AmpC37, sin embargo, en nuestro estudio no descartamos la presencia de plásmidos de tamaños mayores en S. Heidelberg, debido a las limitantes de las técnicas utilizadas. Todo esto concuerda con antecedentes que indicarían que S. Heidelberg contiene un genoma variable, de diferentes tamaños, por la presencia de fagos y plásmidos2,12,30.

Un estudio de cepas de S. Heidelberg aisladas entre 1985 y 2011 en Estados Unidos de Norteamérica mostró que los genes de factores de virulencia en este serovar estaban altamente conservados2, coincidiendo con nuestros resultados, donde los genes de fimbrias (agfA, lpfA, stkD), el gen de invasión celular (invA) y sifA, gen que codifica para un factor de multiplicación bacteriana en macrófago, se detectaron en todos los aislados. Contrariamente, cepas de S. Heidelberg en Brasil mostraron variabilidad en la presencia de agfA6 y otro estudio en Reino Unido mostró variación en stkD15. Además, corroboramos que el gen fimbrial pefA descrito en algunos serovares de Salmonella41 no está en S. Heidelberg, coincidiendo con otro estudio anterior2.

El antibiotipo y las características genéticas de S. Heidelberg aisladas en Chile entre 2006 y 2011, mostró que este serovar presenta alta susceptibilidad a antimicrobianos usados de primera línea en el tratamiento de salmonelosis, con excepción de tetraciclina y ciprofloxacino, donde encontramos resistencia y susceptibilidad disminuida. Además, este estudio nos alerta sobre la circulación de clones que presentan β-lactamasas tipo BLEE y AmpC plasmídicas en nuestro país, lo que puede generar falla de tratamiento en pacientes con infecciones por este serovar y, también, da cuenta de la posibilidad que tienen estas cepas de diseminar la resistencia a cefalosporinas de tercera generación a otras enterobacterias. S. Heidelberg aisladas en Chile tendrían características similares a cepas de otras partes del mundo, codificando para genes de virulencia y con plásmidos de tamaño y número variable. En base a este estudio, proponemos que la presencia de plásmidos en S. Heidelberg podría utilizarse junto a otras herramientas de subtipificación bacteriana. Por otra parte, las características estudiadas no explicarían el aumento de casos ocurridos en Chile por S. Heidelberg el año 2011 respecto a años anteriores.

Apoyo financiero: Dirección de Investigación Universidad de Valparaíso. Proyecto DIUV N° 71/2011.

Agradecimientos:

Al Instituto de Salud Pública de Chile por la donación de las cepas de S. Heidelberg utilizadas en este estudio. Ana Zepeda Ortega, Tecnólogo Médico y PhD. Escuela de Tecnología Médica Universidad de Valparaíso por su colaboración en el análisis estadístico.

Referencias

1. Andrysiak AK, Olson AB, Tracz D, Dore K, Irwin R, Ng LK, et al. Genetic characterization of clinical and agrifood isolates of multi drug resistant Salmonella enterica serovar Heidelberg from Canada. BMC Microbiol 2008; 8: 89. [ Links ]

2. Hoffmann M, Zhao S, Pettengill J, Luo Y, Monday SR, Abbott J, et al. Comparative genomic analysis and virulence differences in closely related salmonella enterica serotype Heidelberg isolates from humans, retail meats, and animals. Genome Biol Evol 2014; 6 (5): 1046-68. [ Links ]

3. Green A, Defibaugh-Chavez S, Douris A, Vetter D, Atkinson R, Kissler B, et al. Intensified Sampling in Response to a Salmonella Heidelberg outbreak associated with multiple establishments within a single Poultry corporation. Foodborne Pathog Dis 2018; 15 (3): 153-60. [ Links ]

4. Zhao S, White DG, Friedman SL, Glenn A, Blickenstaff K, Ayers SL, et al. Antimicrobial resistance in Salmonella enterica serovar Heidelberg isolates from retail meats, including poultry, from 2002 to 2006. Appl Environ Microbiol 2008; 74 (21): 6656-62. [ Links ]

5. Otto S J, Carson CA, Finley RL, Thomas MK, Reid-Smith RJ, McEwen SA. Estimating the number of human cases of ceftiofur-resistant Salmonella enterica serovar Heidelberg in Quebec and Ontario, Canada. Clin Infect Dis 2014; 59 (9): 1281-90. [ Links ]

6. Borsoi A, Santin E, Santos LR, Salle CT, Moraes HL, Nascimento VP. Inoculation of newly hatched broiler chicks with two Brazilian isolates of Salmonella Heidelberg strains with different virulence gene profiles, antimicrobial resistance, and pulsed field gel electrophoresis patterns to intestinal changes evaluation. Poult Sci 2009; 88 (4): 750-8. [ Links ]

7. Chittick P, Sulka A, Tauxe V, Fry AM. A summary of national reports of foodborne outbreaks of Salmonella Heidelberg infections in the United States: clues for disease prevention. J Food Prot 2006; 69 (5): 1150-3. [ Links ]

8. Folster JP, Pecic G, Rickert R, Taylor J, Zhao S, Fedorka-Cray PJ, et al. Characterization of multidrug-resistant Salmonella enterica serovar heidelberg from a ground turkey-associated outbreak in the United States in 2011. Antimicrob Agents Chemother 2012; 56 (6): 3465-6. [ Links ]

9. Folster JP, Pecic G, Singh A, Duval B, Rickert R, Ayers S, et al. Characterization of extended-spectrum cephalosporin-resistant Salmonella enterica serovar Heidelberg isolated from food animals, retail meat, and humans in the United States 2009. Foodborne Pathog Dis 2012; 9 (7): 638-45. [ Links ]

10. Meunier D, Jouy E, Lazizzera C, Doublet B, Kobisch M, Cloeckaert A, et al. Plasmid-borne florfenicol and ceftiofur resistance encoded by the floR and blaCMY-2 genes in Escherichia coli isolates from diseased cattle in France. J Med Microbiol 2010; 59: 467-71. [ Links ]

11. Aarestrup FM, Hasman H, Olsen I, Sorensen G. International spread of bla(CMY-2)-mediated cephalosporin resistance in a multiresistant Salmonella enterica serovar Heidelberg isolate stemming from the importation of a boar by Denmark from Canada. Antimicrob Agents Chemother 2004; 48 (5): 1916-7. [ Links ]

12. Zhang Y, LeJeune JT. Transduction of bla(CMY-2), tet(A), and tet(B) from Salmonella enterica subspecies enterica serovar Heidelberg to S. Typhimurium. Vet Microbiol 2008; 129 (3-4): 418-25. [ Links ]

13. Lindsey RL, Fedorka-Cray PJ, Frye JG, Meinersmann R J. Inc A/C plasmids are prevalent in multidrug-resistant Salmonella enterica isolates. Appl Environ Microbiol 2009; N75 (7): 1908-15. [ Links ]

14. Cejas D, Vignoli R, Quinteros M, Marino R, Callejo R, Betancor L, et al. First detection of CMY-2 plasmid mediated beta-lactamase in Salmonella Heidelberg in South America. Rev Argent Microbiol 2014; 46 (1): 30-3. [ Links ]

15. Bronowski C, Winstanley C. Identification and distribution of accessory genome DNA sequences from an invasive African isolate of Salmonella Heidelberg. FEMS Microbiol Lett 2009; 298 (1): 29-36. [ Links ]

16. Fica A, Acosta G, Dabanch J, Perret C, Torres M, López J, et al. [Salmonellosis outbreaks and the size and role of the Chilean State]. Rev Chilena Infectol 2012; 29: 207-14. [ Links ]

17. Silva J, Aravena C, Araya J, Colque-Navarro P, Kühne I, Mollby R. [Biochemical phenotypes and phage types of Salmonella enteriditis strains isolated in Antofagasta during the period 1997-2000]. Rev Med Chile 2003; 131: 837-45. [ Links ]

18. Grimont P, Weill FX. Antigenic formulae of the Salmonella serovars, 7th edition. WHO Collaborating Centre for Reference and Research on Salmonella. Institut Pasteur, Paris. France. 2007; p. 166. [ Links ]

19. Bauer AW, Kirby WM, Sherris JC, Turck M. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol 1966; 45 (4): 493-6. [ Links ]

20. CLSI (Clinical and Laboratory Standards Institute). Performance Standards for antimicrobial susceptibility testing. Information Supplement M10-S23; Twenty-third edition. 2013. Wayne PA, USA. [ Links ]

21. Takahashi S, Nagano Y. Rapid Procedure for Isolation of Plasmid DNA and Application to Epidemiological Analysis. J Clin Microbiol 1984; 4: 608-13. [ Links ]

22. Fadl AA, Nguyen AV, Khan MI. Analysis of Salmonella enteritidis Isolates by Arbitrarily Primed PCR. J Clin Microbiol 1995; 33 (4): 987-9. [ Links ]

23. Collinson SK, Emody L, Trust TJ, Kay WW. Thin Aggregative fimbriae from diarrheagenic Escherichia coli. J Bacteriol 1992; 174 (13): 4490-5. [ Links ]

24. Zhao S, White DG, McDermott JL, Friedman SL, English L, Ayers S, et al. Identification and Expression of Cephamycinase blaCMY genes in Escherichia coli and Salmonella Isolates from Food Animals and Ground Meat. Antimicrob Agents Chemother 2001; 45 (12): 3647-50. [ Links ]

25. Baümler AJ, Heffron F. Identification and sequence analyses of lpfABCDE, a putative fimbrial operon of Salmonella Typhimurium. J Bacteriol 1995; 177 (8): 2087-97. [ Links ]

26. Haneda T, Okada N, Nagazawa N, Kawakami T, Danbara H. Complete DNA sequence and comparative analysis of the 50-kilobase virulence plasmid of Salmonella enterica serovar Cholerasuis. Infect Inmun 2001; 69 (4): 2612-20. [ Links ]

27. Skyberg JA, Logue CM, Nolan LK. Virulence genotyping of Salmonella spp. with multiplex PCR. Avian Dis 2006; 50 (1): 77-81. [ Links ]

28. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 1977; 74: 5463-7. [ Links ]

29. Phornphisutthimas S, Thamchaipenet A, Panijpan B. Conjugation in Escherichia coli. Biochem Mol Biol Educ 2007; 35 (6): 440-5. [ Links ]

30. Fricke WF, Mammel MK, Dermott PF, Tartera C, White DG, Leclerc JE, et al. Comparative genomics of 28 Salmonella enterica isolates: evidence for CRISPR-mediated adaptive sublineage evolution. J Bacteriol 2011; 193 (14): 3556-68. [ Links ]

31. Kaldhone P, Nayak R, Lynne AM, David DE, Mc Dermott PF, Logue CM, et al. Characterization of Salmonella enterica serovar Heidelberg from turkey-associated sources. Appl Environ Microbiol 2008; 74 (16): 5038-46. [ Links ]

32. Ibar MP, Vigo G, Piñeyro P, Caffer MI, Quiroga P, Perfumo C, et al. Serovariedades de Salmonella enterica subespecie enterica en porcinos de faena y su resistencia a los antimicrobianos. Rev Argen Microbiol 2009; 41 (3): 156-62. [ Links ]

33. Junod T, López-Martin J, Gadicke P. Estudio de susceptibilidad antimicrobiana de Salmonella enterica en muestras de origen animal y alimentario. Rev Med Chile 2013; 141 (3): 298-4. [ Links ]

34. Han J, David DE, Deck J, Lynne AM, Kaldhone P, Nayak, et al. Comparison of Salmonella enterica serovar Heidelberg isolates from human patients with those from animal and food sources. J Clin Microbiol 2011; 49 (3): 1130-3. [ Links ]

35. Kim SY, Lee SK, Park MS, Na HT. Analysis of the Fluoroquinolone Antibiotic Resistance Mechanism of Salmonella enterica Isolates. J Microbiol Biotechnol 2016; 26 (9): 1605-12. [ Links ]

36. El-Tayeb MA, Ibrahim ASS, Al-Salamah AA, Almaary KS, Elbadawi YB. Prevalence, serotyping and antimicrobials resistance mechanism of Salmonella enterica isolated from clinical and environmental samples in Saudi Arabia. Braz J Microbiol 2017; 48: 499-508. [ Links ]

37. Dorr PM, Tadesse DA, Zewde BP, Fry P, Thakur S, Gebreyes WA. Longitudinal Study of Salmonella Dispersion and the Role of Environmental Contamination in Commercial Swine Production Systems. Appl Environ Microbiol 2009; 75 (6): 1478-86. [ Links ]

38. Keelara S, Thakur S. Dissemination of plasmid-encoded AmpC beta-lactamases in antimicrobial resistant Salmonella serotypes originating from humans, pigs and the swine environment. Vet Microbiol 2014; 173 (1-2): 76-83. [ Links ]

39. Gieraltowski L, Higa J, Peralta V, Green A, Schwensohn C, et al. National Outbreak of Multidrug Resistant Salmonella Heidelberg Infections Linked to a Single Poultry Company. PLoS One 2016; 11 (9): e0162369. [ Links ]

40. Han J, Lynne AM, David DE, Tang H, Xu J, Nayak R, et al. DNA sequence analysis of plasmids from multidrug resistant Salmonella enterica serotype Heidelberg isolates. PLoS One 2012; 7 (12): e51160. [ Links ]

41. van Asten AJ, van Dijk JE. Distribution of “classic” virulence factors among Salmonella spp. FEMS Immunol Med Microbiol 2005; 44 (3): 251-9. [ Links ]

Recibido: 06 de Septiembre de 2018; Aprobado: 18 de Diciembre de 2018

Correspondecia a: Carmen Aravena Molló Avda. Miraflores 2085 A. Anexo HOSCA. Casilla 296. San Felipe - V Región. carmen.aravena@uv.cl

La ayuda recibida para la ejecución del proyecto a través de la dirección de Investigación Universidad de Valparaíso y la colaboración del ISP Chile al donar las cepas bacterianas para el estudio, no influenció en el diseño del estudio, en la recolección, análisis o interpretación de los datos, ni en la preparación, revisión o aprobación del manuscrito. Por tanto, no existe conflicto de interés con ninguna de las instituciones que apoyaron este proyecto.

a

Bioquímico.

b

PhD.

c

Tecnólogo Médico.

d

Estudiante de Tecnología Médica.

e

Estudiante de Medicina.

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.