SciELO - Scientific Electronic Library Online

 
vol.47 número3Potencial de los taninos condensados para reducir las emisiones de metano entérico y sus efectos en producción de rumiantesComparación del perfil de ácidos grasos de la leche entre tres sistemas distintos de producción lechera en la Región de Los Ríos, Chile índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Archivos de medicina veterinaria

versión impresa ISSN 0301-732X

Arch. med. vet. vol.47 no.3 Valdivia  2015

http://dx.doi.org/10.4067/S0301-732X2015000300003 

ORIGINAL ARTICLE

 

Evaluation of the use of recombinant proteins of Mycobacterium bovis as antigens in intradermal tests for diagnosis of bovine tuberculosis#

Evaluación de uso de las proteínas recombinantes de Mycobacterium bovis como antígenos en las pruebas intradérmicas para el diagnóstico de la tuberculosis bovina

 

ESP Meloa*, IIF Souzaa, CAN Ramosb, ALAR Osóriob, NV Verbisckc, FR Araújoc

a Pós Graduação em Ciencia Animal, Universidade Federal de Mato Grosso do Sul, Mato Grosso do Sul, Brazil.
b
Universidade Federal de Mato Grosso do Sul, Mato Grosso do Sul, Brazil.
c
Embrapa Gado de Corte, Campo Grande, Brazil.
# FUNDECT, Programa de Desenvolvimiento Científico y Tecnológico Regional, 23/200.107/2014.
* Avenida Senador Filinto Muller, Vila Ipiranga, 79070-900, Campo Grande - MS, Brazil; elainespmelo@hotmail.com


RESUMEN

La prueba itradérmica de la piel con derivados de proteína (PPD) purificada a partir de Mycobacterium bovis se ha utilizado para el diagnóstico de la tuberculosis bovina. Sin embargo, debido a la especificidad subóptima de esta mezcla de proteínas, la mejora de las pruebas basadas en antígenos específicos definidos son necesarias. En el presente estudio, las proteínas recombinantes de M. bovis se evaluaron como antígenos en la prueba cutánea. Entre estas, EsxI, Mb0143, PE5 y PE13 son antígenos probados por primera vez en el ganado. Bovinos sensibilizados y no sensibilizados con la cepa AN5 inactivada de M. bovis fueron inyectados simultáneamente con cada proteína recombinante, un cóctel con todas las proteínas recombinantes, PPD de M. bovis, PPD de M. avium y salina. Solo las proteínas EsxI, Mb0143 y PE5 fueron capaces de diferenciar ganado sensibilizado de lo no sensibilizado cuando se usó 320 irg de proteína y la lectura realizada 24 horas después de la inyección. EsxI y PE5 exhibieron un nivel de sensibilidad de 83,33% y una especificidad de 100% y 80%, respectivamente. Los resultados del presente estudio sugieren que las proteínas recombinantes tienen el potencial de ser evaluadas como antígenos en las pruebas cutáneas en el ganado.

Palabras clave: tuberculosis bovina, prueba intradérmica, EsxI, PE5.


SUMMARY

The skin test with purified protein derivatives (PPD) from Mycobacterium bovis has been used for the diagnosis of bovine tuberculosis. However, due to the suboptimal specificity of this protein mixture, improved tests based on defined specific antigens are needed. In the present study, recombinant proteins from M. bovis were evaluated as antigens in the skin test. Among these proteins, EsxI, Mb0143, PE5, and PE13 are antigens tested for the first time in skin test on cattle. Sensitised and non-sensitised cattle to the inactivated AN5 strain of M. bovis were simultaneously injected with each recombinant protein, a cocktail with all recombinant proteins, M. bovis PPD, M. avium PPD and saline. Only the proteins EsxI, Mb0143 and PE5 were able to differentiate sensitised and non-sensitised cattle when 320 irg of protein was used and the reading done 24 hours post-injection. EsxI and PE5 exhibited a sensitivity level of 83.33% and specificity of 100% and 80%, respectively. The results of the present study suggest that the recombinant proteins have potential to be assessed as antigens in skin tests in cattle.

Key words: bovine tuberculosis, recombinant proteins, skin test, EsxI, PE5.


 

INTRODUCTION

Bovine tuberculosis is a disease of both economic and zoonotic importance caused by members of the Mycobacterium tuberculosis complex, particularly Mycobacterium bovis (Wobeser 2009, Michel et al 2010). Bovine tuberculosis eradication programs involve the detection and elimination of infected animals (Ministério da Agricultura, Pecuária e Abastecimento 2004, Álvarez et al 2012). The detection of infected cattle is based mainly on the cell-mediated immune response (McNair et al 2007, Good and Duignan 2011) assessed through an intradermal tuberculin test (skin test) and interferon-gamma (IFN-y) assay (Rothel et al 1992).

The skin test involves the measurement of increased skin fold thickness 72 h after the intradermal injection of mycobacterial extracts, termed purified protein derivatives (PPD). However, due the complexity of these reagents and the sharing of antigenic components between pathogenic and nonpathogenic mycobacteria, PPD do not always allow the discrimination between cattle infected with virulent M. bovis and non-infected cattle sensitised by environmental mycobacteria and Mycobacterium avium subsp. avium or M. avium subsp.paratuberculosis (Waters et al 2004, Pollock et al 2005, Schiller et al 2010,). Thus, the comparison with responses to M. avium PPD is often used to facilitate the discrimination between cattle infected with M. bovis and those exposed to environmental strains (Pollock et al 2005).

Despite the broad usage of this assay, skin test sensitivity reports range from 68 to 95%, whereas specificity (for the comparative test) ranges from 96 to 99% (Monaghan et al 1994, Whelan et al 2004, De La Rua-Domenech et al 2006). Furthermore, there is evidence that PPD inoculation may sensitise the animals, thereby affecting the result of a subsequent skin test in the same animal (Thom et al 2004). It is possible that repeated tuberculin testing may affect the results of other blood-based immune assays used to diagnose tuberculosis (Thom et al 2004, Coad et al 2010). The complexity of tuberculin, the presence of cross-reactive components, and the low specificity have fueled the search for new antigens and diagnostic assays specific to M. bovis (Pollock et al 2005, Aagaard et al 2010).

In recent years, a large number of proteins from M. bovis have been purified and characterised (Harboe et al 1996, Wiker et al 1998, Rhodes et al 2000, Mustafa et al 2006, Sidders et al 2008, Jones et al 2010). However, only some of them have been evaluated as antigens in the skin test on cattle as an alternative to traditional PPD, such as ESAT-6 (Pollock et al 2003, Whelan et al 2010, Flores-Villalva et al 2012), CFP-10, MPB70 and MPB83 (Whelan et al 2010). Although promising results have been observed with the use of ESAT-6 and CFP-10 either individually (Pollock et al 2003) or in cocktail combinations (Whelan et al 2010, Casal et al 2012), there is no sufficient evidence to date to support the replacement of traditional PPD with these recombinant proteins, mainly due to problems regarding sensitivity (Pollock et al 2003, Whelan et al 2010). Jones et al (2010) reported a sensitivity level of 87.5% and specificity of 97.6% using a protein cocktail of ESAT-6/ CFP-10/Rv-3615c with the addition of Rv3020c. Whelan et al (2010) reported sensitivity and specificity of 73.6% and 100% respectively using a cocktail of recombinant proteins composed of ESAT-6/CFP-10/MPB70/MPB83. Thus, there is a need to evaluate other recombinant proteins from M. bovis in skin tests on cattle.

Based on previous reports of diagnosis of tuberculosis in cattle using IFN-y assays (EsxI, Mb0143, PE5, PE13 and TB10.4) (Aagaard et al 2006, Jones et al 2010, Meikle et al 2009), the aim of the present study was to assess these recombinant proteins with respect to the ability to differentiate M. bovis sensitised and non-sensitised cattle by skin test, for further evaluation of the best antigens in infected animals.

MATERIAL AND METHODS

ETHICAL ASPECTS

The use of cattle was approved by the Ethics Committee on Animal Use of the Universidade Federal de Mato Grosso do Sul, Brazil (protocol 321/11). All experiments were carried out in accordance with international norms and regulations.

CATTLE SENSITISATION

Cattle from the Caracu breed (n = 29), approximately 24 months of age and with a mean weight of 408 kg, raised at Embrapa Beef Cattle, Campo Grande, MS, Brazil, were used. The animals came from a herd with no clinical or pathological history of tuberculosis during the last 3 years, as evidenced by inspection at slaughter. In addition, all the animals used were negative in ELISA based on MPB70 and P27 recombinant antigens, according to Farias et al (2012). Twenty-four animals were sensitised by subcutaneous injection of 10 mg of inactivated heat (96-105 °C for 30 min) M. bovis AN5 strain, which was supplied by the LANAGRO/ Brazilian Ministry of Agriculture (Pedro Leopoldo, Brazil) to simulate the immunological response observed in M. bovis infected animals. In addition, five animals were only inoculated with sterile saline solution to simulate non-infected cattle. After sensitisation, all animals were kept in the isolation area of Embrapa Beef Cattle, Brazil. In order to avoid any possibility of prior sensitization of experimental animals, they have not been previously submitted to comparative intradermal tuberculin test (CITT).

GENE AMPLIFICATION

M. bovis DNA (AN5 strain) was purified from cultures in Stonebrink's medium using a commercial kit (DNeasy Blood & Tissue kit, Qiagen).

Primer sets were used to amplify the genes mb0143 (Rv0138), pe5 (Rv0285), pe13 (Rv1195) and tb10.4 (Rv0288) as described by Souza et al (2012). The primer set for the esxI (Rv1037c) gene (forward: 5' TATCAATTCGGGGACGTCGACGCTCACG 3' and reverse: 5' GGCGCTGTCGGTTTGTGCCATGTTGTTG 3') were designed using the PrimerSelect program (DNAStar). The primers were designed to amplify the full length of the genes.

Polymerase chain reactions were performed in a volume of 25 |il containing 20 mM of Tris (pH 8.4), 50 mM of KCl, 1.5 mM of MgCl2, 250 uM of each dNTP, 100 ng of each primer, 0.2 U of Taq DNA polymerase (Invitrogen) and 50 ng of M. bovis DNA. The amplification protocol was as follows: 95 °C for 4 min followed by 30 cycles of 95 °C for 1 min (denaturation), annealing for 30 sec at 56 °C (pe5), 58°C (pe13, tb10.4), 64 °C (mb0143) and 65 °C (esxI), extension for 30 sec at 72 °C. A final step of extension was performed at 72 °C for 4 min.

GENE CLONING, PRODUCTION AND EVALUATION OF RECOMBINANT PROTEINS

Following amplification, the genes were initially cloned into the pGEM-T Easy (Promega) plasmid, following the manufacturer's instructions, and subcloned into pET47-b (Novagen), except tb10.4, which was subcloned into pET28-a (Novagen) at the EcoRI site. The plasmid was thus extracted, purified and sequenced in order to evaluate the integrity of the cloned gene sequence.

The Escherichia coli Rosetta strain was used as the host cells for all DNA constructs. The induction of gene expression was performed using 1 mM of isopropyl-β-D-ga-lactopyranoside (IPTG) in 500 ml of Luria-Bertani broth supplemented with 50 μg/ml of chloramphenicol and 30 μg/ml of kanamycin at 30 °C for 4 h at 200 rpm. Gene expression was confirmed by sodium dodecyl-polyacryl-amide gel electrophoresis (SDS-PAGE) and Western blot with the anti-6x-histidine monoclonal antibody (Sigma).

Recombinant proteins were solubilized with 6 M of HCl-guanidine and purified using agarose-nickel resin His-Trap HP (GE Healthcare), following the manufacturer's instructions. Recombinant proteins were dialyzed with PBS at 4 °C for 48 h and concentrations were determined by comparisons with known concentrations of bovine serum albumin in SDS-PAGE using the Lablmage v.3.3.2 image analysis software (Loccus, Brazil).

Molecular masses of the recombinant proteins were analysed by MALDI-TOF mass spectrometry using an Autoflex III spectrometer (Bruker Daltonics). Proteins were mixed with 2.5-dihydroxybenzoic acid (Sigma-Aldrich) by dried droplet method and spectra were acquired after 1000 laser shots in linear positive mode under external calibration with ProteoMass calibrants (Sigma-Aldrich).

All recombinant proteins used in this study were previously evaluated in ELISA as described by Souza et al (2012) and were recognised by antibodies (IgG) of cattle naturally infected with M. bovis.

SKIN TESTING

Sixty days after sensitization, the animals were separated into three groups. Two groups were each composed of twelve sensitised cattle and the third group was formed by five non-sensitised animals. All animals received an intradermal inoculation of 100 μg of M. bovis PPD (2606 IU) and 50 μg of M. avium PPD (2397 IU) at a volume of 0.1 ml (following the technical regulations of the National Brucellosis and Tuberculosis Control and Eradication Program of the Brazilian Ministry of Agriculture [PNCBT]) (Ministerio da Agricultura, Pecuária e Abastecimento 2004). All PPD were supplied by the Instituto de Tecnologia do Paraná -TECPAR (Curitiba, Brazil). The first group of sensitised cattle received 160 μg of each recombinant protein (EsxI, Mb0143, PE5, PE13 and TB10.4), a cocktail containing 32 μg of each protein and sterile saline at final volume of 0.16 ml. The second sensitised group received 320 μg of each recombinant protein, a cocktail containing 64 μg of each protein and saline at final volume of 0.32 ml. Three non-sensitised animals received all proteins injections at final volume of 0.16 ml and two non-sensitised animals received injections at final volume of 0.32 ml. The protein concentrations used in this experiment were established based on previous evaluations in experiments with guinea pigs (Cavia porcellus) (data not shown).

Nine intradermal injection sites were established on each animal, four on one side and five on the other side of the neck, with a distance of approximately 15 cm between inoculation sites. The inoculation sites were alternated systematically in each animal to minimize any bias related to the inoculation site.

The results were expressed as the difference in skin thickness in millimeters (mm) between the pre- and post-skin test measurements at 24, 48 and 72 h following intradermal inoculation (Ministerio da Agricultura, Pecuaria e Abastecimento 2006). The technicians were blinded to both identification of inoculum and the sites of the inoculations during measurements. The comparative intradermal tuberculin test (CITT) was interpreted based on the technical regulations of the PNCBT/Brazil (positive reactions = Δ skin thickness for M. bovis PPD - M. avium PPD 4mm).

STATISTICAL ANALYSIS

The increase in skin fold thickness (in mm) with each combination of protein, concentration and post-injection reading time was compared with respective measurements in non-sensitised animals using the nonparametric Mann-Whitney test. Differences in skin fold thickness between non-sensitised animals inoculated with 0.16 ml or 0.32 ml of inoculum were also analysed using the Mann-Whitney test. The sensitivity and specificity of the best combinations (protein, concentration and reading time), resulting in a significant difference between sensitised and non-sensitised cattle, were interpreted using a cut-off point 1mm, as used by Whelan (2010), also in experiments with recombinant proteins in cattle. P values below 0.05 were considered statistically significant. The statistical analyses were performed using BioEstat version 5.0 (Sociedade Mamiraud, Belem, Brazil).

RESULTS

Gene expression was determined by SDS-PAGE and Western blot. In Western blot, all recombinant proteins were recognized by the anti-6x-histidine antibody, thereby confirming gene expression. The molecular masses of the recombinant proteins was confirmed by MALDI-TOF mass spectrometry revealed the proteins EsxI, Mb0143, PE5, PE13 and TB10.4 to have 18.4, 20.4, 7.9, 17.3 and 13.9 KDa, respectively.

The M. bovis sensitised animals used in this experiment exhibited a significant response to M. bovis PPD (median = 17.75 mm; interquartile range = 16.8 to 21.0). All were considered positive to the cervical comparative tuberculin skin test interpreted based on Brazilian legislation. The non-sensitised cattle exhibited a weak response to M. bovis PPD (median = - 0.6 mm; interquartile range = - 1.2 to 1.0) and all were negative based on the same interpretation criteria (Δ skin thickness 4 mm, 72 h post-injection). The responses to M. avium PPD showed a median of increase in skin fold thickness of 0.4 mm (interquartile range = - 0.85 to 0.95) in non-sensitised cattle, and 3.5 mm (interquartile range = 2.5 to 4.2) in sensitised animals.

No significant differences (P > 0.05) were observed between non-sensitised animals inoculated with 0.16 or 0.32 mL of inoculum. Thus, these animals were analysed as a single group.

Significant differences in the increase in skin fold between M. bovis sensitised (n = 12) and non-sensitised cattle (n = 5) were observed only with the proteins EsxI (P = 0.039; 95% CI -0.136 to 2.036), Mb0143 (P = 0.039; 95% CI 0.054-1.409) and PE5 (P = 0.030; 95% CI 0.7272.781), when 320 μg of protein was used and the reading performed 24 hours post-injection (figure 1).

 


Figure 1. Skin test response to individual proteins of M. bovis, a cocktail of all proteins,
M. bovis
and M. avium PPD; response measured in sensitised (■) and non-sensitised (O) cattle;
letters represent amount of injected protein and post-injection reading time: a) 160
μg/ 24 h;
b) 320
μg/ 24 h; c) 160 μg/ 48 h; d) 320 μg/ 48 h; e) 160 μg/ 72 h; f) 320 μg/ 72 h;
closed circles (•) represent outliers; asterisk (*) indicates significant difference between sensitised
and non-sensitised cattle.
Respuesta de la prueba cutánea a las proteínas individuales de M. bovis, un cóctel de todas las
proteínas, PPD de M. bovis y M. avium; la respuesta se mide en el ganado sensibilizado (■) y no
sensibilizado (O); las letras representan cantidad de proteína inyectada y tiempo de lectura después
de la inyección: a) 160
μg/ 24 h; b) 320 μg/ 24 h; c) 160 μg/ 48 h; d) 320 μg/ 48 h; e) 160 μg/ 72 h;
f ) 320
μg/ 72 h; círculos cerrados (•) representan los valores extremos; asterisco (*) indica diferencias
significativas entre el ganado sensibilizado y no sensibilizado.

 

Table 1 displays the sensitivity and specificity of EsxI, Mb0143 and PE5 (320 μg/24 h) in the skin test to differentiate between sensitised and non-sensitised animals, based on a criteria of interpretation 1 mm.

 

Table 1. Sensitivity and specificity at the specific cut-off point of recombinant EsxI, Mb0143,
PE5 and M. bovis PPD as antigens in a tuberculin skin test in cattle.
La sensibilidad y la especificidad en el punto de corte específico de EsxI, Mb0143, PE5
recombinantes y PPD de M. bovis como antígenos en la prueba cutánea de la tuberculina en el ganado.

M. bovis PPD used in Comparative Intradermal Tuberculin Test.
** Standard PNCBT-Brazil.
* PPD de M. bovis usado en la Prueba de Tuberculina Intradérmica Comparativa.
** Estándar PNCBT-Brasil.

 

Figure 2 displays the comparison of reaction sizes to M. bovis PPDs (read at 72 h post-injection) and EsxI, Mb0143 and PE5 (read at 24 h post-injection). Significant differences (P = 0.001) were found in skin fold produced by the PPD in relation to the recombinant proteins.

 


Figure 2. Comparison of median of skin test responses induced
by M. bovis PPD, protein EsxI, Mb0143 and PE5 in twelve cattle
sensitised with inactivated M. bovis AN5 strain. The statistical
difference between the antigens was determined by the MannWhitney
test (*P < 0.05; **P < 0.001).
Comparación de la mediana de las respuestas de las pruebas cutáneas
inducidas por PPD de M. bovis, proteínas EsxI, Mb0143 y PE5 en doce
bovinos sensibilizados con la cepa M. bovis AN5 inactivada. La diferencia
estadística entre los antígenos se determinó mediante la prueba de
Mann-Whitney (*P < 0,05; **P < 0,001).

 

All animals used in this experiment were slaughtered (at the end of experiment) and no lesions suggestive of BTB were found during meat inspection at an official slaughterhouse.

DISCUSSION

ESAT-6 and CFP-10, are two important proteins for the diagnosis of M. bovis in cattle by the skin test and IFN-y assays (Vordermeier et al 2001, Aagaard et al 2003, Waters et al 2004, Aagaard et al 2006, Whelan et al 2010, Casal et al 2012). Despite the promising results obtained by the use of ESAT-6 and cocktails combinations of ESAT-6 and CFP-10 in previous studies (Pollock et al 2003, Whelan et al 2003, Whelan et al 2010, Casal et al 2012), there is no sufficient evidence to date to support the replacement of traditional PPD by these recombinant proteins, showing that it is necessary to evaluate other proteins as antigens.

In the present study only the proteins EsxI, Mb0143 and PE5 (320 μg/ 24 h) induced significant differences between sensitised and non-sensitised cattle. Readings at 48 and 72 hours did not allow the differentiation between M. bovis sensitised and non-sensitised cattle. However, the animals used in this experiment were experimentally sensitised with the inactivated AN5 strain of M. bovis and the delayed-type hypersensitivity (DTH) response may be significantly different from the response observed in naturally infected cattle, especially in the chronic phase of infection (Cockle et al 2006).

In the present study, proteins, such as EsxI (Jones et al 2010), Mb0143, PE5, PE13 and TB10.4 previously assessed in IFN-γ assays (Aagaard et al 2006, Meikle et al 2009), were evaluated in skin test in cattle. Excluding TB10.4, which was recently evaluated in skin test in cattle by Xin et al (2013), all the other proteins were assessed for the first time in skin test in bovines.

In previous assessments of recombinant proteins as antigens in skin test in cattle, only experimentally infected (Pollock et al 2003, Xin et al 2013) or naturally infected (Whelan et al 2010, Casal et al 2012) animals had been used. In the present study, for the first time, sensitised animals were used. Although performing the skin test in cattle experimentally infected with virulent M. bovis might have been preferable, the model using sensitisation with a subcutaneous inoculation of an AN5 strain appears to be suitable, since an intense M. bovis PPD response was observed in all of the sensitised animals. This method represents an interesting alternative for the screening of antigens for a skin test in cattle.

In the present study, EsxI and PE5 exhibited a sensitivity level of 83.3% (10/12), and specificity of 100% (5/5) and 80% (4/5) respectively, using a cut-off point 1 mm. Based on the same criteria of interpretation, Whelan et al (2010) reported a sensitivity level of 73.6% and specificity of 100% using a protein cocktail (ESAT-6, CFP-10, MPB70 and MPB83) in cattle naturally exposed to M. bovis, whereas Jones et al (2010) reported 75% and 87.5%, respectively, using a peptide combination of ESAT-6/CFP-10/Rv3615c or ESAT-6/CFP-10/Rv3615c/Rv3020c. Recently, Xin et al (2013) reported sensitivity and specificity of 94.02% and 95.2% respectively, using the same criteria of interpretation (cut-off point 1 mm) and a protein cocktail composed by CFP10/ESAT-6/TB10.4.

Although artificially sensitised animals were used in the present study, and as mentioned above, the immune response may be significantly different from naturally infected cattle, the parameters of sensitivity and specificity observed for EsxI and PE5 were very close to those observed with other proteins in skin tests (Jones et al 2010, Whelan et al 2010). These results are very interesting because EsxI is a secreted protein member of the ESAT-6 family (Mtb 9.9 subfamily) (Jones et al 2010), and perhaps its inclusion in a protein cocktail with ESAT-6 and CFP-10 could improve the sensitivity and specificity of the skin test. On the other hand, PE5 is a member of the PE family that is present in the mycobacterial cell wall, and is considered, along with TB10.4 and PE13, to be an antigen that is sensitive and highly specific in the IFN-γ assay (Aagaard et al 2006). Although Mb0143 was also considered a satisfactory antigen in IFN-γ assay to identify experimentally infected cattle (Meikle et al 2009), its sensitivity levels were not satisfactory in the skin test.

In the present study, the combination of different antigens in a cocktail did not favour the differentiation of sensitised and non-sensitised cattle, although some proteins allowed such a differentiation individually. A definitive explanation for these results is not known.

However, the amount of each protein injected in a cocktail format (32 or 64 μg/protein), in contrast to the amount used individually (160 or 320 μg/ protein) may have influenced these findings. In addition, Kalra et al (2010) proposed that protein-protein interaction and their immunocompatibility, in terms of recognition of different leukocyte antigen alleles and competition for antigen processing and presentation, should be considered before combining two or more antigens.

Inconsistent results have been observed in different cattle studies regarding the amount of protein necessary to produce a perceptible DTH. The use of 10 μg (Whelan et al 2010) up to 400 μg (Pollock et al 2003) of recombinant protein has been reported. In the present study, the amount of protein evaluated (160 and 320 μg) was based on a previous evaluation in an experiment with guinea pigs (data not shown) and significant differences in skin fold between M. bovis sensitised and non-sensitised cattle were observed only when 320 μg of EsxI, Mb0143 or PE5 were used.

Despite the significant difference in skin fold thickness produced by the M. bovis PPD in relation to the recombinant proteins, it was possible to differentiate sensitised from non-sensitised cattle with EsxI and PE5, with satisfactory levels of sensitivity and specificity. Significant differences in the magnitude of the reactions of M. bovis PPD and recombinant proteins have been reported in previous studies (Pollock et al 2003, Whelan et al 2010), and consequently cut-off points of few millimeters have been utilized to interpret recombinant proteins or synthetic peptide skin tests (Pollock et al 2003, Jones et al 2010, Whelan et al 2010, Casal et al 2012). In the present study, the median of increase in skin fold thickness in the reactions to the Mb0143 antigen was only 0.5 mm (interquartile range = 0.25 to 1), whereas median values were 1.2 mm (interquartile range = 0.87 and 1.82) for EsxI and 1.95 mm (interquartile range = 1.15 to 2.52) for PE5. Although the full explanation for this finding is not known, the inherent antigenicity of each protein may be considered.

In experiments with recombinant proteins produced in E. coli, endotoxin contamination should be considered as a possible inducer of unspecific skin reactions. Although the endotoxin level in the samples of recombinant proteins was not measured in the present study, the influence of this toxin in the skin reactions is believed to have been non-significant. Skin fold thickness induced by recombinant proteins EsxI, Mb0143 and PE5 (24 h post-injection) in non-sensitised animals exhibited no significant differences in the Mann-Whitney test in relation to the reactions induced by sterile saline.

The results of this comparison suggest that reactions observed in sensitised animals are specific to the recombinant proteins and not due to endotoxin or other E. coli protein contamination. Moreover, nonspecific reactions due to sensitization with environmental mycobacteria were unlikely, since skin thickness induced by M. avium PPD in the non-sensitised animals was negligible. The reactions among sensitised animals were consistent with the findings of Almeida et al (2006) (median of increase in skin fold = 6.15 mm, interquartile range = 3.87 to 7.77) in cattle sensitised by heat inactivated M. bovis AN5 and non-reactive for M. avium in the IFN-γ assay.

Another important issue in the results observed in the present study is related to the time at which the skin test reactions induced by recombinant proteins (mainly EsxI and PE5) peaked (24 h post-injection). Skin thickness induced by PPD normally peaks after 72 h, and it has been found that recombinant proteins such as ESAT-6 also peak after approximately 72 h (Pollock et al 2003, Whelan et al 2010). This was not observed for any of the proteins used in the present study. Immunologically, a DTH is a local T-cell mediated inflammatory reaction that evolves over 24-72 h, and cutaneous DTH in cattle have been reported to peak at 24 h (Hernández et al 2005). Therefore, it is not possible to exclude the hypothesis that the reactions observed in the present study were DTH reactions. However, an incontestable confirmation would only be possible by performing histological analysis of the inoculation sites. Although interesting results were obtained with the proteins EsxI and PE5 in artificially sensitised animals, an assessment with naturally infected animals is required to assess the real potential of these proteins as antigens in skin tests.

The results reported herein suggest that the proteins EsxI and PE5 have potential to be assessed as antigens in skin tests in cattle. However, more studies are needed, especially in cattle naturally infected by M. bovis.

 

REFERENCES

Aagaard C, M Govaerts, L Meng Okkels, P Andersen, JM Pollock. 2003. Genomic approach to identification of Mycobacterium bovis diagnostic antigens in cattle. J Clin Microbiol 41, 3719-3728.         [ Links ]

Aagaard C, M Govaerts, V Meikle, AJ Vallecillo, JA Gutiérrez-Pabello, F Suárez-Guemes, J McNair, A Cataldi, C Espitia, P Andersen, JM Pollock. 2006. Optimizing antigen cocktails for detection of Mycobacterium bovis in herds with different prevalences of bovine tuberculosis: ESAT6-CFP10 mixture shows optimal sensitivity and specificity. J Clin Microbiol 44, 4326-4335.         [ Links ]

Aagaard C, M Govaerts, V Meikle, JA Gutiérrez-Pabello, J McNair, P Andersen, F Suárez-Guemes, J Pollock, C Espitia, A Cataldi. 2010. Detection of bovine tuberculosis in herds with different disease prevalence and influence of paratuberculosis infection on PPDB and ESAT-6/CFP10 specificity. Prev Vet Med 96, 161-169.         [ Links ]

Almeida RFC, CR Madruga, CO Soares, MC Fernandes, NM Carvalho, KSG Jorge, ALAR Osório. 2006. Specific imune response of cattle to experimental sensibilization by inactivated Mycobacterium bovis and Mycobacterium avium. Braz J Vet Res 26, 195-200.         [ Links ]

Álvarez J, A Pérez, B Javier, S Marqués, A Grau, JL Sáez, O Mínguez, L Juan, L Domínguez. 2012. Evaluation of the sensitivity and specificity of bovine tuberculosis diagnostic tests in naturally infected cattle herds using a Bayesian approach. Vet Microbiol 155, 38-43.         [ Links ]

Casal C, J Bezos, A Díez-Guerrier, J Álvarez, B Romero, L Juan, S Rodríguez-Campos, M Vordermeier, A Whelan, RG Hewinson, A Mateos, L Domínguez, A Aranaz. 2012. Evaluation of two cocktails containing ESAT-6, CFP-10 and Rv-3615c in the intradermal test and the interferon-"/ assay for diagnosis of bovine tuberculosis. Prev Vet Med 105, 149-154.         [ Links ]

Coad M, D Clifford, SG Rhodes, RG Hewinson, HM Vordermeier, AO Whelan. 2010. Repeat tuberculin skin testing leads to desensitization in naturally infected tuberculous cattle which is associated with elevated interleukin-10 and decreased interleukin-1 beta responses. Vet Res 41, 14.         [ Links ]

Cockle PJ, SV Gordon, RG Hewinson, HM Vordermeier. 2006. Field evaluation of a novel differential diagnostic reagent for detection of Mycobacterium bovis in cattle. Clin Vac Immunol 13, 1119-1124.         [ Links ]

De la Rúa-Domenech R, AT Goodchild, HM Vordermeier, RG Hewinson, KH Christiansen, RS Clifton-Hadley. 2006. Ante mortem diagnosis of tuberculosis in cattle: A review of the tuberculin tests, γ-interferon assay and other ancillary diagnostic techniques. Res Vet Sci 81, 190-210.         [ Links ]

Farías TA, FR Araújo, ALAR Osório, KSG Jorge, CAN Ramos, IIF Souza, A Azambuja, CO Soares, MR Silva, AO Pellegrin. 2012. ELISA based on recombinant MPB70 and P27 for detection of antibodies against Mycobacterium bovis. Rev Pat Trop 41, 155-162.         [ Links ]

Flores-Villalva S, F Suárez-Güemes, C Espitia, AO Whelan, HM Vordermeier, JA Gutiérrez-Pabello. 2012. Tuberculin skin test specificity is modified by the use of a protein cocktail containing ESAT-6 and CFP-10 in Mycobacterium bovis naturally infected cattle. Clin Vac Immunol 19, 797-803.         [ Links ]

Good M, A Duignan. 2011. Perspectives on the history of bovine TB and the role of tuberculin in bovine TB eradication. Vet Med Int 2011. doi: 10.4061/2011/410470        [ Links ]

Harboe M, T Oettinger, HG Wiker, I Rosenkrands, P Andersen. 1996. Evidence for occurrence of the ESAT-6 protein in Mycobacterium tuberculosis and virulent Mycobacterium bovis and for its absence in Mycobacterium bovis BCG. Infect Immun 64, 16-22.         [ Links ]

Hernández A, JA Yager, BN Wilkie, KE Leslie, BA Mallard. 2005. Evaluation of bovine cutaneous delayed-type hypersensitivity (DTH) to various test antigens and a mitogen using several adjuvants. Vet Immunol Immunopathol 104, 45-58.         [ Links ]

Jones GJ, RG Hewinson, HM Vordermeier. 2010. Screening of predicted secreted antigens from Mycobacterium bovis identifies potential novel differential diagnostic reagents. Clin Vac Immunol 17, 1344-1348.         [ Links ]

Kalra M, GK Khuller, JA Sheikh, I Verma. 2010. Evaluation of Mycobacterium tuberculosis specific RD antigens for delayed type hypersensitivity responses in guinea pig. Indian J Exp Biol 48, 117-123.         [ Links ]

McNair J, MD Welsh, JM Pollock. 2007. The immunology of bovine tuberculosis and progression toward improved disease control strategies. Vaccine 25, 5504-5511.         [ Links ]

Meikle V, A Alito, AS Llera, A Gioffre, A Peralta, BM Buddle, A Cataldi. 2009. Identification of novel Mycobacterium bovis antigens by dissection of crude protein fractions. Clin Vac Immunol 16, 1352-1359.         [ Links ]

Michel AL, B Müller, PD van Helden. 2010. Mycobacterium bovis at the animal-human interface: A problem, or not? Vet Microbiol 140, 371-381.         [ Links ]

Ministerio da Agricultura, Pecuária e Abastecimento, Brasil. 2004. Programm Nacional de Controle e Erradicação da Brucelose e da Tuberculose Animal (PNCEBT). Secretaria de Defesa Agropecuária -Departamento de Saúde Animal.MAPA/SDA/DSA, Brasilia, Brasil.         [ Links ]

Monaghan ML, ML Doherty, JD Collins, JF Kazda, PJ Quinn. 1994. The tuberculin test. Vet Microbiol 40, 111-124.         [ Links ]

Mustafa AS, YA Skeiky, R Al-Attiyah, MR Alderson, RG Hewinson, HM Vordermeier. 2006. Immunogenicity of Mycobacterium tuberculosis antigens in Mycobacterium bovis BCG-vaccinated and M. bovis-infected cattle. Infect Immun 74, 4566-4572.         [ Links ]

Pollock JM, J McNair, H Bassett, JP Cassidy, E Costello, H Aggerbeck, I Rosenkrands, P Andersen. 2003. Specific delayed-type hypersensitivity responses to ESAT-6 identify tuberculosis-infected cattle. J Clin Microbiol 41, 1856-1860.         [ Links ]

Pollock JM, MD Welsh, J McNair. 2005. Immune responses in bovine tuberculosis: Towards new strategies for the diagnosis and control of disease. Vet Immunol Immunopathol 108, 37-43.         [ Links ]

Rhodes SG, D Gavier-Widen, BM Buddle, AO Whelan, M Singh, RG Hewinson, HM Vordermeier. 2000. Antigen specificity in experimental bovine tuberculosis. Infect Immun 68, 2573-2578.         [ Links ]

Rothel JS, SL Jones, LA Corner, JC Cox, PR Wood. 1992. The gamma-interferon assay for diagnosis of bovine tuberculosis in cattle: conditions affecting the production of gamma-interferon in whole blood culture. Aust Vet J 69, 1-4.         [ Links ]

Schiller I, HM Vordermeier, WR Waters, AO Whelan, M Coad, E Gormley, BM Buddle, M Palmer, T Thacker, J McNair, M Welsh, RG Hewinson, B Oesch. 2010. Bovinetuberculosis: Effect of the tuberculin skin test on in vitro interferon gamma responses. Vet Immunol Immunopathol 136, 1-11.         [ Links ]

Sidders B, C Pirson, PJ Hogarth, RG Hewinson, NG Stoker, HM Vordermeier, K Ewer. 2008. Screening of highly expressed mycobacterial genes identifies RV3615c as a useful differential diagnostic antigen for the Mycobacterium tuberculosis complex. Infect Immun 76, 3932-3939.         [ Links ]

Souza IIF, ESP Melo, CAN Ramos, TA Farias, ALAR Osorio, KSG Jorge, CES Vidal, AS Silva, MR Silva, AO Pellegrin, FR Araujo. 2012. Screening of recombinant proteins as antigens in indirect ELISA for diagnosis of bovine tuberculosis. SpringerPlus 77, 1-6.         [ Links ]

Thom M, JH Morgan, JC Hope, B Villarreal-Ramos, M Martin, CJ Howard. 2004. The effect of repeated tuberculin skin testing of cattle on immune responses and disease following experimental infection with Mycobacterium bovis. Vet Immunol Immunopathol 102, 399-412.         [ Links ]

Vordermeier HM, A Whelan, PJ Cockle, L Farrant, N Palmer, RG Hewinson. 2001. Use of synthetic peptides derived from the antigens ESAT-6 and CFP-10 for differential diagnosis of bovine tuberculosis in cattle. Clin Diag Lab Immunol 8, 571-578.         [ Links ]

Waters WR, BJ Nonnecke, MV Palmer, S Robbe-Austermann, JP Bannantine, JR Stabel, DL Whipple, JB Payeur, DM Estes, JE Pitzer, FC Minion. 2004. Use of recombinant ESAT-6:CFP-10 fusion protein for differentiation of infections of cattle by Mycobacterium bovis and by M. avium subsp. avium and M. avium subsp. paratuberculosis. Clin Diag Lab Immunol 11, 729-735.         [ Links ]

Whelan AO, JC Hope, CJ Howard, D Clifford, RG Hewinson, HM Vordermeier. 2003. Modulation of the bovine delayed-type hypersensitivity responses to defined mycobacterial antigens by a synthetic bacterial lipopeptide. Infect Immun 71, 6420-6425.         [ Links ]

Whelan AO, M Coad, ZA Peck, D Clifford, RG Hewinson, HM Vordermeier. 2004. Influence of skin testing and overnight sample storage on blood-based diagnosis of bovine tuberculosis. Vet Rec 155, 204-206.         [ Links ]

Whelan AO, D Clifford, B Upadhyay, EL Breadon, J McNair, GR Hewinson, MH Vordermeier. 2010. Development of a skin test for bovine tuberculosis for differentiating infected from vaccinate animals. J Clin Microbiol 48, 3176-3181.         [ Links ]

Wiker HG, KP Lyashchenko, AM Aksoy, KA Lightbody, JM Pollock, SV Komissarenko, SO Bobrovnik, IN Kolesnikova, LO Mykhalsky, ML Gennaro, M Harboe. 1998. Immunochemical characterization of the MPB70/80 and MPB83 proteins of Mycobacterium bovis. Infec Immun 66, 1445-1452.         [ Links ]

Wobeser G. 2009. Bovine tuberculosis in Canadian wildlife: An updated history. Can Vet J 50, 1169-1176.         [ Links ]

 


Accepted: 26.02.2015

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons