SciELO - Scientific Electronic Library Online

 
vol.28 número4Índices predictores de eventos adversos en el adulto inmunocompetente hospitalizado por neumonía neumocóccica adquirida en la comunidadActualización Consenso Neumonía asociada a ventilación mecánica: Segunda parte. Prevención índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Revista chilena de infectología

versión impresa ISSN 0716-1018

Rev. chil. infectol. vol.28 no.4 Santiago ago. 2011

http://dx.doi.org/10.4067/S0716-10182011000500002 

Rev Chil Infect 2011; 28 (4): 310-315

Artículo Original

Diagnóstico de la infección por Treponema pallidum en pacientes con sífilis temprana y neurosífilis mediante reacción de la polimerasa en cadena

Laboratory diagnosis of Treponema pallidum infection in patients with early syphilis and neurosyphilis through a PCR-based test

 

Patricia García C., Bruno Grassi C., Félix Fich S., Aurelio Salvo L., Luis Araya C., Fernando Abarzúa C., Julia Soto M., Helena Poggi M., Marcela Lagos L., Patricia Vásquez T., Eugenia P. León C., Carlos Pérez C. yAniela Wozniak B.

Pontificia Universidad Católica de Chile
Departamento de Laboratorios Clínicos:
Laboratorio de Microbiología (PGC, EPLC, AWB).
Unidad Docente de Apoyo: Dermatología (FFS).
División Ginecología y Obstetricia
(FAC).
Laboratorio de Biología Molecular (JSM, HPM, MLL).
Departamento de Medicina Interna (CPC).
Escuela de Medicina (BGC).


Hospital San Juan de Dios, Santiago.

Servicio de Neurología (LAC).
Unidad de Infectología (PVT).

Hospital Sótero Del Río, Santiago.
Servicio de Dermatología (ASL).


Abstract

Syphilis is a sexually transmitted disease caused by Treponema pallidum. The diagnosis is based mainly in clinical presentation and non-specific assays. PCR-based diagnosis has been suggested as an attractive alternative method. The aim of this study was the validation of a PCR-based test for the diagnosis of early syphilis (ES) and neurosyphilis (NS). Clinical samples of mucocutaneous lesions and cerebrospinal fluid (CSF) specimens from patients previously diagnosed for ES and NS respectively using an enlarged gold standard, were tested by PCR. The reaction was done using primers targeting the tpN47gene. Twenty out of 21 mucocutaneous samples from patients diagnosed with ES were positive by PCR, with a clinical sensitivity of 95%. Four out of 8 CSF samples from patients previously diagnosed with NS were positive by PCR, with a clinical sensitivity of 50%. The clinical specificity for both ES and NS was 100%. The PCR sensitivity and specificity for mucocutaneous samples allowed us to implement this assay in our laboratory for routine diagnosis. Although the sensitivity of the PCR in CSF was low, it may be useful to support clinical diagnosis.

Key words: Treponema pallidum, syphilis, polymerase chain reaction, diagnosis.


Resumen

La sífilis es una enfermedad de transmisión sexual producida por Treponema pallidum, cuyo diagnóstico se realiza presuntivamente basándose en aspectos clínicos y análisis de especificidad limitada. La reacción de la polimerasa en cadena (RPC) ha sido planteada como una alternativa diagnóstica de mayor sensibilidad y especificidad. El objetivo de este trabajo fue validar una RPC para el diagnóstico de sífilis temprana (ST) y neurosífilis (NS). Se utilizaron muestras de lesiones muco-cutáneas y de LCR de pacientes con sospecha de cursar ST y NS respectivamente, previamente diagnosticados, utilizando un estándar de oro ampliado. La RPC fue realizada con partidores dirigidos al gen tpN47. De las 21 muestras de pacientes con ST, la RPC resultó positiva en 20, lo que resulta en una sensibilidad clínica de 95%. De las 8 muestras de pacientes con NS, la RPC resultó positiva en 4, obteniéndose una sensibilidad clínica de 50%. La especificidad clínica para ST y NS fue de 100%. La excelente sensibilidad y especificidad de la RPC para muestras muco-cutáneas permitió la exitosa implementación de este análisis en nuestro laboratorio para el diagnóstico de rutina. Si bien la sensibilidad de la RPC en LCR es baja, es muy útil para apoyar el diagnóstico clínico.

Palabras clave: Treponema pallidum, sífilis, reacción de polimerasa en cadena, diagnóstico.


 

Introducción

La sífilis es una enfermedad de transmisión sexual, de carácter crónico, que evoluciona en fases clínicas: sífilis primaria, secundaria, latente y terciaria. El agente etiológico de la sífilis, Treponema pallidum, es una espiroqueta no cultivable1. Durante los últimos años se han registrado brotes de esta enfermedad en varios países, incluso en naciones desarrolladas como Canadá (National Infectious Disease Examiner.com -Syphilis spikes in Alberta, Canada- health officials looking for solutions. URL: http://www.examiner.com). En Alberta, una provincia de Canadá, existe una gran preocupación debido a que el número de casos de sífilis en 1999 fue dos y en 2009 ascendió a 267 casos, probablemente debido a la promiscuidad sexual de las personas, principalmente entre 15 y 35 años. El problema de la sífilis es más grave en la era del VIH, debido a que las úlceras genitales aumentan la probabilidad de contagio del virus2,3. En Latinoamérica, entre 1995 y 1999, el número de casos nuevos por año se elevó de 1,26 millones a 2,93, ocupando el tercer lugar mundialmente4. Respecto a la situación en Chile, hasta octubre del año 2010 se notificaron 2.433 casos de sífilis, cifra inferior a la registrada en el año 2009 (n = 2.646), pero superior a la mediana del quinquenio anterior (n = 2.275), alcanzando una tasa de incidencia de 14,2 por cien mil habitantes. Los casos de sífilis en mujeres embarazadas también han aumentado significativamente5.

Durante la sífilis primaria, el patógeno ingresa por la epidermis produciendo lesiones erosivas indoloras en los genitales llamadas chancro duro6. Un alto porcentaje de los pacientes infectados desarrolla la enfermedad sistémica conocida como sífilis secundaria. Esta se caracteriza por la aparición de rash cutáneo en palmas de las manos y plantas de los pies, exantema sifilítico en el tórax y abdomen, alopecia, sifilides en la boca, lengua, área genital, anal y perianal y condilomas planos en el área genital7. Las etapas primaria y secundaria de la sífilis se caracterizan por lesiones en la piel y mucosas que son fuente de contagio de la enfermedad. Ambas formas corresponden a sífilis temprana (ST) (menos de un año de evolución). Luego de la sífilis secundaria, el paciente entra en un período asintomático llamado sífilis latente. Los pacientes infectados que no son tratados tienen ~ 40% de probabilidad de desarrollar sífilis terciaria, entre 1 y 30 años después de la primo-infección. La invasión del sistema nervioso central (SNC) se puede presentar durante la sífilis secundaria o durante la sífilis terciaria, con manifestaciones variadas desde un cuadro asintomático hasta una parálisis general por compromiso extenso del SNC8. A esta enfermedad que compromete el SNC se la llama neurosífilis (NS). El diagnóstico de la enfermedad debe ser certero, ya que el tratamiento de la sífilis secundaria sin compromiso del SNC y de la NS son diferentes, debido a la imposibilidad de la bencil-penicilina-G de alcanzar concentraciones adecuadas en el SNC. En la NS, la terapia antimicrobiana debe realizarse en el paciente hospitalizado, con penicilina sódica endovenosa9,10.

El momento óptimo para el diagnóstico e inicio de tratamiento es durante la sífilis primaria. Los métodos serológicos de diagnóstico son de gran utilidad durante las etapas primaria y secundaria de la enfermedad. Estas pruebas pueden ser negativas durante los primeros estadios de la sífilis primaria; sin embargo, la expresión clínica de la enfermedad es crucial para el diagnóstico en este momento2,11. En la etapa terciaria, no sólo se observa un bajo título de anticuerpos, sino además una baja carga infectante en el SNC, lo cual dificulta mucho el diagnóstico que, por lo tanto, se basa principalmente en las manifestaciones clínicas. Adicionalmente, se sabe que hay un alto número de falsos positivos en la serología asociados a diversas condiciones como embarazo, edad avanzada, mesenquimopatías y neoplasias12.

Dado que no es posible cultivar esta bacteria, el diagnóstico de la enfermedad requiere métodos alternativos al cultivo12-14. El estándar de oro para la detección de T. pallidum es el test de "infectividad" en conejos (en inglés rabbit infectivity test -RIT), el cual requiere disponibilidad de animales y un tiempo prolongado de análisis, por lo que resulta impracticable en el laboratorio clínico15,16. En la actualidad, se utilizan de rutina métodos serológicos no treponémicos (VDRL, RPR), treponémicos (fluorescent treponemal antibody absorption- FTA-Abs; ELISA; microhemagglutination test for antibodies to Treponema pallidum, MHA-Tp) y métodos directos como la micros-copia de campo oscuro (MCO), la inmunofluorescencia directa (DFA-TP), o tests de amplificación de ácidos nucleicos (en inglés nucleic acid amplification test-NA-ATs)12,16-18. El diagnóstico presuntivo de la sífilis se realiza básicamente basándose en aspectos clínicos y requiere de un test no treponémico positivo más un test treponémico positivo confirmatorio. Los tests no treponémicos, así como los treponémicos, son ampliamente usados en el laboratorio clínico para el diagnóstico presuntivo. Sin embargo, el diagnóstico definitivo requiere de un test directo positivo12. En muchos casos los tests directos no son aplicables. La MCO requiere una alta carga bacteriana que sólo es posible observar durante la sífilis primaria, además no distingue entre espiroquetas patogénicas y no patogénicas y la muestra debe ser observada antes de 30 minutos desde su toma, lo cual limita su uso masivo16. La DFA-TP es un método de gran sensibilidad y especificidad pero el reactivo que requiere no está disponible para los laboratorios de diagnóstico, sino que sólo para los laboratorios de referencia19.

Debido a las limitaciones de los métodos disponibles en la actualidad, el diagnóstico de sífilis es poco específico. En este contexto, se ha planteado el uso de NAATs basados en la reacción de la polimerasa en cadena (RPC) para la detección de T. pallidum20-22. Estos tests se basan principalmente en la detección de dos genes: el gen tpN47 que codifica para la proteína de membrana de 47 kDa22-26 y el genpolA que codifica para la ADN polimerasa I2127. La RPC dirigida al gen de la proteína de 47 kDa se ha utilizado ampliamente para detectar T. pallidum en distintos tejidos, mostrando sensibilidades similares al RIT en muestras de úlceras genitales y en sangre total15,23. Sin embargo, su uso en LCR ha demostrado tener sensibilidades menores a éstas, alrededor de 65%9 y 67%23. Por otra parte, el uso de la RPC para el gen polA ha sido reportado con sensibilidad de 95,8% para úlceras genitales27 y de 41% para sangre total28. El uso de la RPC para polA en LCR como método diagnóstico de NS no ha sido descrito.

El objetivo del presente trabajo es evaluar la sensibilidad y especificidad clínicas de una RPC en lesiones muco-cutáneas y en muestras de LCR de pacientes que posean diagnóstico clínico de ST y NS, para contribuir a la detección definitiva de la enfermedad en todas sus etapas y demostrar que se trata de un método efectivo, susceptible de ser implementado en la práctica clínica.

Material y Método

Pacientes y diagnóstico clínico de acuerdo al estándar de oro ampliado

Se estudiaron en forma prospectiva 34 muestras de lesiones muco-cutáneas de 32 pacientes con sospecha de ST. Las muestras provenían del Centro Médico San Joaquín y Hospital Sótero Del Río y fueron tomadas entre junio de 2005 y junio de 2007. De estos pacientes, 21 (62%) eran hombres. También se estudiaron 34 muestras de LCR de 31 pacientes con sospecha de cursar NS procedentes del Hospital San Juan de Dios, que fueron aisladas durante el mismo período de tiempo; 77% (24/31) de estos pacientes eran hombres. Los pacientes fueron seleccionados entre los que acudieron a la Policlínica de Dermatología de dichos centros médicos padeciendo lesiones muco-cutáneas sugerentes de ST o síntomas/signos clínicos sugerentes de NS. En todos los pacientes se utilizó para el diagnóstico clínico un gold standard ampliado1. En el caso de ST, consistió en la conjunción de los antecedentes clínicos, VDRL/RPR en suero y MCO en una muestra muco-cutánea. En el caso de NS, consistió en la conjunción de antecedentes clínicos, VDRL, análisis citoquímico de LCR (celularidad, proteinorraquia, glucorraquia), respuesta al tratamiento y ausencia de otra enfermedad.

Tamaño de muestra. Teniendo en cuenta que la detección de T. pallidum por RPC dirigido al gen de la proteína de 47 kDa tiene una sensibilidad de 95% en muestras muco-cutáneas22, para obtener un n considerable de 20 muestras positivas se requieren 21 muestras muco-cutáneas. Teniendo en cuenta que la misma RPC tiene una sensibilidad de 65% en muestras de LCR9, para obtener un n considerable de 20 muestras positivas se requieren 30 muestras de LCR. El protocolo fue aprobado por el Comité de Ética de la Facultad de Medicina (Pontificia Universidad Católica de Chile).

Diagnóstico clínico de sífilis temprana. El diagnóstico de ST de acuerdo al estándar de oro ampliado fue el criterio de inclusión para realizar la detección de T. pallidum por RPC en muestras muco-cutáneas. Según dicho estándar de oro ampliado, se confirmó sífilis primaria en siete de las 34 muestras con sospecha de ST, en 15 se confirmó sífilis secundaria y en 12 un diagnóstico diferente a sífilis, siendo una de ellas condiloma acuminado, otra herpes anal y 10 herpes simplex tipo 2 determinado por RPC. De los 22 pacientes con diagnóstico de ST, seis de ellos eran seropositivos para VIH. El VDRL/RPR en el suero de los pacientes con ST fue reactivo en todos y el título osciló entre 1:2 y 1:512. En el suero de los pacientes con condiloma acuminado y herpes simplex anal el VDRL/ RPR fue no reactivo. La MCO se realizó en 12 muestras de pacientes con ST y la misma fue positiva en seis de ellos (50%) y negativa en los otros seis (50%). En la muestra correspondiente a herpes anal la MCO fue negativa.

Diagnóstico clínico de neurosífilis. El diagnóstico de NS, de acuerdo al estándar de oro ampliado, fue el criterio de inclusión para realizar la detección de T. pallidum por RPC en muestras de LCR. Según dicho estándar de oro ampliado, en ocho de las 33 muestras de pacientes con sospecha de NS, el diagnóstico se confirmó clínicamente. Seis de estos ocho pacientes (75%) eran hombres. Cuatro de estos ocho pacientes (57%) eran seropositivos para VIH, y de los pacientes sin diagnóstico de NS, 16 de 23 (70%) eran seropositivos para VIH. El VDRL en LCR fue reactivo en siete de los ocho pacientes con NS y el título osciló entre 1:2 y 1:8 mientras que en uno de los ocho pacientes el MHA-Tp fue positivo. El análisis citoquímico en LCR de los pacientes con NS mostró las siguientes características: dos de los ocho pacientes (25%) mostraron aumento de celularidad, la proteinorraquia estuvo aumentada en tres pacientes (38%) y la glucorraquia se encontró dentro de valores normales para los ocho pacientes con NS. Esto demuestra una baja concordancia entre NS y el análisis citoquímico de LCR. Con respecto a los 23 pacientes con diagnóstico diferente a NS, uno de ellos (4%) presentó aumento de celularidad, sólo dos (9%) tuvieron una proteinorraquia aumentada y ninguno de ellos tuvo una glucorraquia disminuida.

Extracción de ADN. Las muestras de lesiones muco-cutáneas fueron transportadas en tubo estéril con solución salina y las de LCR en tubo estéril. Posteriormente, fueron centrifugadas a 13.000 rpm durante 10 min. El ADN se extrajo utilizando el método comercial Blood-Tissue kit (QIAgen, Hilden, Alemania) siguiendo las instrucciones del fabricante.

Evaluación de la sensibilidad analítica. La sensibilidad analítica del método se determinó realizando la RPC con diluciones seriadas del ADN extraído a partir de una suspensión de una cantidad conocida de microorganismos. Para ello, se extrajo ADN a partir de una suspensión in-activada de la cepa de referencia de T. pallidum (Nichols) con 3,5 x 107 bacterias/ml y la misma se re-suspendió en 1 ml de tampón acetato-EDTA. Para la RPC se utilizaron 5 ¡¡L de las diluciones 10-3, 104, 10-5, 10-6 y 10-7 del ADN extraído, los cuales contienen el ADN de 1.750; 175; 17,5; 1,75 y 0,175 bacterias, respectivamente. Se utilizó una pareja de partidores para el gen de la proteína de 47 kDa tpN47 (partidores K03-K04) [22] y dos parejas para el gen de la ADN polimerasa polA (partidores F1-R1 y F2-R2)27. La secuencia de los partidores fue la siguiente: K03: 5'-GAAGTTTGTCCCAGTTGCGGTT-3' K04: 5'-CAGAGCCATCAGCCCTTTTCA-3' F1: 5'- TGCGCGTGTGCGAATGGTGTGGTC -3' R1: 5'- CACAGTGCTCAAAAACGCCTGCACG -3' F2: 5' - CGTCTGGTCGATGTGCAAATGAGTG -3' R2: 5' - TGCACATGTACACTGAGTTGACTCGG -3'

Se realizó una RPC convencional en un volumen de 25 ¡xL en un termociclador Perkin Elmer (Applied Biosystems). La mezcla de reacción contenía tampón de RPC 10x (50 mM KCl, 10 mM TE, 3 mM MgCl2, 12% glicerol), una concentración final 50 nM de cada partidor, dNTPs, 5 de ADN, y 1,75 U de Taq polimerasa. El programa de amplificación fue del tipo touch-down el cual se usa para amplificar ADNs que se encuentran en baja cantidad. El mismo consiste en una desnaturalización inicial de 3 min a 95°C y 10 ciclos sucesivos en los cuales la desnaturalización es de 30 s a 95°C y la extensión de 30 s a 72°C. El "annealing" es de 30 s a 65°C para el primero de los 10 ciclos y cada ciclo sucesivo disminuye un °C hasta llegar a 56°C. Posteriormente ocurren 35 ciclos iguales de 30 s a 95°C, 30 s a 55°C y 30 s a 72°C. Por último, ocurre una extensión final de 10 min a 72°C. Los tubos se almacenaron a 4°C hasta la detección del producto de RPC en gel de agarosa al 1,5%.

Evaluación de la sensibilidad y especificidad clínicas.

Una vez determinada la pareja de partidores con mayor sensibilidad analítica, se procedió a analizar la sensibilidad clínica de la RPC en las muestras clínicas.

Como control negativo se utilizó una muestra de ADN humano extraído por el mismo método, como control positivo se utilizó una dilución de la cepa Nichols de un orden de magnitud mayor a la sensibilidad analítica del método (10-5) y como control de calidad de la muestra (ausencia de inhibición y efectividad de la extracción), se amplificó el gen de la P-globina humana. Con los datos de la RPC se construyó una tabla de 2 x 2 para el cálculo de la sensibilidad y especificidad clínicas, y también de los valores predictores positivo (VPP) y negativo (VPN).

Resultados

Determinación de la sensibilidad analítica de la RPC

Se determinó la sensibilidad analítica de la técnica realizando RPC dirigida al gen tpn47 (partidores K03-K04) utilizando como molde soluciones que contienen una cantidad de ADN correspondiente a 1.750; 175; 17,5; 1,75 y 0,175 bacterias. Se observó que la RPC es capaz de detectar el ADN de 1.750; 175; 17,5 y 1,75 bacterias; sin embargo, no es capaz de detectar el ADN de 0,175 bacterias (Figura 1, gel superior). Por lo tanto, la sensibilidad analítica de la técnica es de 1,75 bacterias/ RPC para la pareja de partidores dirigidos al gen tpn47. Se determinó además la sensibilidad analítica para dos parejas de partidores dirigidas al gen polA (parejas de partidores F1-R1 y F2-R2). La sensibilidad analítica de esta RPC fue 10 y 100 veces inferior a la de la RPC dirigida gen tpn47 para las parejas de partidores F1-R1 y F2-R2, respectivamente (Figura 1, gel inferior). Por lo tanto, para la determinación de la sensibilidad clínica del método se utilizará la pareja de partidores K03-K04.




Determinación de la sensibilidad y especificidad clínicas de la RPC

De las 22 muestras con diagnóstico de ST, la RPC resultó positiva en 20 (Figura 2). En una de las muestras negativas, la RPC resultó inhibida, por lo que fue excluida de todo cálculo y análisis. En base a estas cifras, se obtuvo una sensibilidad clínica de 95% (20/21). La muestra con RPC negativa correspondía a un paciente con VDRL/RPR reactivo (título 1:64). La muestra fue tomada de una placa eritematosa no erosiva ni ulcerada. El paciente padecía rash cutáneo y había sido diagnosticado presuntivamente con sífilis secundaria. Tanto las seis muestras con MCO positiva como las cinco muestras con MCO negativa tuvieron una RPC positiva. En las 12 muestras con diagnóstico diferente a sífilis la RPC resultó negativa, por lo que se obtuvo una especificidad de 100% (12/12) (Tabla 1A). Los VPP y VPN para la detección de T. pallidum por RPC en muestras muco-cutáneas fueron: 100 y 92%, respectivamente, lo cual demuestra que esta prueba tiene una buena performance en este tipo de muestra.

De las ocho muestras de LCR con diagnóstico de NS, la RPC fue positiva en cuatro, lo cual resulta en una sensibilidad de 50% (4/8). En los 23 pacientes con diagnóstico diferente a NS, la RPC fue negativa, resultando en una especificidad de 100% (23/23) (Tabla 1B). El VPP y VPN para muestras de LCR es de 100 y 85%, respectivamente, lo cual demuestra que si la RPC es positiva, la probabilidad de tener enfermedad es de 100%. Sin embargo, si el resultado de la prueba es negativo, la probabilidad de no tener la enfermedad no es lo suficientemente alta como para poder descartarla. De los cuatro pacientes con NS que tuvieron una RPC positiva, sólo uno de ellos tuvo la proteinorraquia aumentada y sólo uno tuvo la celularidad aumentada, lo cual demuestra la baja concordancia entre NS y análisis citoquímico de LCR.





Discusión

Los resultados obtenidos en el presente trabajo muestran una excelente sensibilidad clínica de la RPC de T. pallidum de 95% (20/21 muestras) para lesiones muco-cutáneas. Cabe destacar, además, que la RPC fue positiva en cinco muestras que presentaban resultados de laboratorio discordantes con VDRL/RPR reactivos y MCO negativa. En estos casos la RPC es una herramienta de gran ayuda y su uso permite un diagnóstico y tratamiento oportunos. Además, este método de diagnóstico podría ser de gran utilidad en pacientes que presenten alguna condición que altera los resultados de la serología habitual para T. pallidum, como lo son el embarazo, la edad avanzada, las mesenquimopatías y las neoplasias8,29. Estos resultados nos permiten concluir que la RPC para T. pallidum en pacientes con sospecha de ST es útil en casos cuyo diagnóstico por las técnicas de uso habitual es poco concluyente. Por estas razones, la detección de T. pallidum por RPC en muestras muco-cutáneas ha sido implementada exitosamente en nuestro laboratorio.

Nuestros resultados muestran una baja sensibilidad clínica (50%) de la RPC para diagnóstico de NS, lo cual es concordante con la literatura científica revisada9,23-25. Esto se debe probablemente a la baja carga infectante en LCR. Además, la baja concordancia observada entre NS y alteración de parámetros del análisis citoquímico de LCR, sugieren una utilidad limitada de este análisis en el diagnóstico de NS30. Cabe destacar que el bajo número de muestras de LCR es una limitante en este estudio y pudo haber afectado los cálculos de sensibilidad y especificidad realizados. Sin embargo, los valores calculados en la Tabla 1B son un buen reflejo de los resultados obtenidos. Dado que en la actualidad no existe un método diagnóstico con una sensibilidad analítica mayor a la descrita para la RPC, el diagnóstico de NS debe seguir basándose en la suma de las manifestaciones clínicas y exámenes de rendimiento limitado. Sin embargo, si bien una RPC negativa no permite descartar la enfermedad, una RPC positiva en LCR confirmaría el diagnóstico de NS. En estos casos, el diagnóstico de NS por RPC puede tener gran utilidad y de esta manera contribuir al tratamiento y mejoría de dichos pacientes. La utilidad de esta técnica consiste en dilucidar casos complejos o dudosos, particularmente en el área materno-infantil. Por esta razón, la RPC en LCR para diagnóstico de NS también ha sido implementada en nuestro laboratorio con el objetivo de complementar el diagnóstico clínico. Esta es la primera vez que se implementa un método de biología molecular para el diagnóstico de T. pallidum en el ámbito del laboratorio clínico en Chile. Si bien no reemplaza a los métodos tradicionales, este método molecular es de gran ayuda en el diagnóstico de la sífilis.

Agradecimientos. Agradecemos a la Q.F. Sra. Liliana Urra por el apoyo prestado para la realización de este trabajo.

Referencias

1. - Tramont E. Treponema pallidum (Syphilis). In: Mandell, Douglas & Bennett's Principles and Practice of Infectious Diseases. Mandell GL, Bennett JE, Dolin R, eds. 7th ed. Orlando, FL:Churchill Livingstone Elsevier, 2010; 3035-53.         [ Links ]

2. - Ficarra G, Carlos R. Syphilis: the renaissance of an old disease with oral implications. Head Neck Pathol 2009; 3 (3):195-206.         [ Links ]

3. - Fleming D T, Wasserheit J N. From epidemiological synergy to public health policy and practice: the contribution of other sexually transmitted diseases to sexual transmission of HIV infection. Sex Transm Infect 1999; 75 (1): 3-17.         [ Links ]

4. - Organización Mundial de la Salud (OMS). http://www.who.int/docstore/hiv/GRSTI/005. htm. (accedido octubre 2010).

5. - Gobierno de Chile. Ministerio de Salud. Boletín de Electrónico Mensual de Vigilancia Epidemiológica N° 88. Vigilancia de Sífilis. http://www.epi.minsal.cl . (accedido octubre 2010).

6. - Goh BT. Syphilis in adults. Sex Transm Infect 2005; 81 (6): 448-52.         [ Links ]

7. - Peeling R W, Hook E W, 3rd. The pathogenesis of syphilis: the Great Mimicker, revisited. J Pathol 2006; 208 (2): 224-32.         [ Links ]

8. - Singh A E, Romanowski B. Syphilis: review with emphasis on clinical, epidemiologic, and some biologic features. Clin Microbiol Rev 1999; 12 (2): 187-209.         [ Links ]

9. - Michelow I C, Wendel G D, Jr, Norgard M V, Zeray F, Leos N K, Alsaadi R, et al. Central nervous system infection in congenital syphilis. N Engl J Med 2002; 346(23): 1792-8.         [ Links ]

10. - Workowski K A, Berman S M. Sexually transmitted diseases treatment guidelines, 2006. MMWR Recomm Rep 2006; 55 (RR-11): 1-94.         [ Links ]

11. - Young H. Syphilis. Serology. Dermatol Clin 1998; 16 (4): 691-8.         [ Links ]

12. - Sokolovskiy E, Frigo N, Rotanov S, Savicheva A, Dolia O, Kitajeva N, et al. Guidelines for the laboratory diagnosis of syphilis in East European countries. J Eur Acad Dermatol Venereol 2009; 23 (6): 623-32.         [ Links ]

13. - Larsen S A, Steiner B M, Rudolph A H. Laboratory diagnosis and interpretation of tests for syphilis. Clin Microbiol Rev 1995; 8 (1): 1-21.         [ Links ]

14. - Tucker J D, Bu J, Brown L B, Yin Y P, Chen X S, Cohen M S. Accelerating worldwide syphilis screening through rapid testing: a systematic review. Lancet Infect Dis 2010; 10 (6): 381-6.         [ Links ]

15. - Sánchez P J, Wendel G D Jr, Grimprel E, Goldberg M, Hall M, Arencibia-Mireles O, et al. Evaluation of molecular methodologies and rabbit infectivity testing for the diagnosis of congenital syphilis and neonatal central nervous system invasion by Treponema pallidum. J Infect Dis 1993; 167 (1): 148-57.         [ Links ]

16. - Wicher K, Horowitz H W, Wicher V. Laboratory methods of diagnosis of syphilis for the beginning of the third millennium. Microbes Infect 1999; 1 (12): 1035-49.         [ Links ]

17. - Heymans R, van der Helm J J, de Vries H J, Fennema H S, Coutinho R A, Bruisten S M. Clinical value of Treponema pallidum real-time PCR for diagnosis of syphilis. J Clin Microbiol; 48 (2): 497-502.         [ Links ]

18. - Scott L J, Gunson R N, Carman W F, Winter A J. A new multiplex real-time PCR test for HSV1/2 and syphilis: an evaluation of its impact in the laboratory and clinical setting. Sex Transm Infect 2010; 86 (7): 537-9.         [ Links ] Epub 2010 Jul 18.

19. - Chen C Y, Chi K H, George R W, Cox D L, Srivastava A, Rui Silva M, et al. Diagnosis of gastric syphilis by direct immunofluorescence staining and real-time PCR testing. J Clin Microbiol 2006; 44 (9): 3452-6.         [ Links ]

20. - Gayet-Ageron A, Ninet B, Toutous-Trellu L, Lautenschlager S, Furrer H, Piguet V, et al. Assessment of a real-time PCR test to diagnose syphilis from diverse biological samples. Sex Transm Infect 2009; 85 (4): 264-9.         [ Links ]

21. - Leslie D E, Azzato F, Karapanagiotidis T, Leydon J, Fyfe J. Development of a real-time PCR assay to detect Treponema pallidum in clinical specimens and assessment of the assay's performance by comparison with serological testing. J Clin Microbiol 2007; 45 (1): 93-6.         [ Links ]

22. - Palmer H M, Higgins S P, Herring A J, Kingston M A. Use of PCR in the diagnosis of early syphilis in the United Kingdom. Sex Transm Infect 2003; 79 (6): 479-83.         [ Links ]

23. - Chung K Y, Lee M G, Lee J B. Detection of Treponema pallidum by polymerase chain reaction in the cerebrospinal fluid of syphilis patients. Yonsei Med J 1994; 35 (2): 190-7.         [ Links ]

24. - Grimprel E, Sánchez P J, Wendel G D, Burstain J M, McCracken G H Jr, Radolf J D, et al. Use of polymerase chain reaction and rabbit infectivity testing to detect Treponema pallidum in amniotic fluid, fetal and neonatal sera, and cerebrospinal fluid. J Clin Microbiol 1991; 29(8): 1711-8.         [ Links ]

25. - Jethwa H S, Schmitz J L, Dallabetta G, Behets F, Hoffman I, Hamilton H, et al. Comparison of molecular and microscopic techniques for detection of Treponema pallidum in genital ulcers. J Clin Microbiol 1995; 33 (1): 180-3.         [ Links ]

26. - Lai W, Chen C Y, Morse S A, Htun Y, Fehler H G, Liu H, et al. Increasing relative prevalence of HSV-2 infection among men with genital ulcers from a mining community in South Africa. Sex Transm Infect 2003; 79 (3): 202-7.         [ Links ]

27. - Liu H, Rodes B, Chen C Y, Steiner B. New tests for syphilis: rational design of a PCR method for detection of Treponema pallidum in clinical specimens using unique regions of the DNA polymerase I gene. J Clin Microbiol 2001; 39 (5): 1941-6.         [ Links ]

28. - Marfin A A, Liu H, Sutton M Y, Steiner B, Pillay A, Markowitz L E. Amplification of the DNA polymerase I gene of Treponema pallidum from whole blood of persons with syphilis. Diagn Microbiol Infect Dis 2001; 40 (4): 163-6.         [ Links ]

29. - Abarzúa C F, Belmar J C, Rioseco R A, Parada B J, Quiroga GT, García CP. Pesquisa de sífilis congénita al momento del parto: ¿Suero materno o sangre de cordón? Rev Chil Infectol 2008; 25 (3): 155-61.         [ Links ]

30. - Marra C M, Maxwell C L, Tantalo L C, Sahi S K, Lukehart S A. Normalization of serum rapid plasma reagin titer predicts normalization of cerebrospinal fluid and clinical abnormalities after treatment of neurosyphilis. Clin Infect Dis 2008; 47 (7): 893-9.         [ Links ]


Financiamiento:
Proyecto financiado por Fondos Departamentales Concursables del Departamento de Laboratorios Clínicos.

Conflictos de interés:
No hay conflictos de interés.

Recibido: 14 de diciembre de 2010
Aceptado: 6 de junio de 2011

Correspondencia a:
Aniela Wozniak Banchero
aniela.wozniak@gmail.com

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons