SciELO - Scientific Electronic Library Online

 
vol.35 issue4Requiem aeternam OPVEvaluation of the prescription, consumption and costs of antifungal drugs in a pediatric hospital in Chile author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Revista chilena de infectología

Print version ISSN 0716-1018

Rev. chil. infectol. vol.35 no.4 Santiago Aug. 2018

http://dx.doi.org/10.4067/s0716-10182018000400343 

Artículo Original

Antimicrobianos

Evaluación de susceptibilidad y respuesta al tratamiento con piperacilina/tazobactam en pacientes con infecciones por Escherichia coli productoras de β-lactamasas de espectro extendido (BLEE) CTX-M

Evaluation of susceptibility and response to therapy with piperacillin-tazobactam in patients with infections caused by Escherichia coli with extended-spectrum β-lactamase (ESBL) CTX-M

Jorge Álvarez1 

Álvaro Rojas1 

Camila Carvajal1 

Javier Revello1 

Paulina Meza2 

Piero Guggiana2 

Patricia García2 

Jaime Labarca1 

1Escuela de Medicina. Departamento de Enfermedades Infecciosas. Pontificia Universidad Católica de Chile.

2Escuela de Medicina. Departamento de Laboratorios Clínicos. Laboratorio de Microbiología. Pontificia Universidad Católica de Chile.

Resumen

Introducción:

En las infecciones por enterobacterias productoras de β-lactamasas de espectro extendido (BLEE), los β-lactámicos preferidos para tratamiento son los carbapenémicos. Sin embargo, estudios clínicos muestran eficacia de piperacilina/tazobactam en ciertas infecciones por Escherichia coli productoras de BLEE.

Objetivo:

Determinar la cura clínica y microbiológica con piperacilina/tazobactam en pacientes con infecciones por E. coli productoras de BLEE, tipo CTX-M.

Materiales/Métodos:

Estudio descriptivo, retrospectivo, con adultos internados en un hospital universitario. Incluimos infecciones del tracto urinario (ITU), intra-abdominales (IIA) e infecciones de tejidos blandos (ITB).

Resultados:

Estudiamos 40 pacientes, donde 65% correspondían a ITU, 25% IIA y 10 % ITB. La cura clínica global se logró en 89,4%, con mejores resultados en las ITU (100%), seguidas de ITB (80%) e IIA (70%). El 85% de las cepas tenía concentraciones inhibitorias mínimas (CIM) ≤ 8 μg/mL y 70% con CIM ≤ 4 μg/mL. La tasa de fracaso fue mayor en las infecciones con inóculos altos intraabdominales. La BLEE del tipo CTX-M-15 se encontró en 62,5%.

Conclusiones:

Piperacilina/tazobactam logró cura clínica y microbiológica, en pacientes con infecciones por E. coli productoras de BLEE susceptibles, especialmente en ITU e IPB y en menor medida en IIA.

Palabras clave: β-lactamasas de espectro extendido; concentración inhibitoria mínima; piperacilina/tazobactam; CTX-M

ABSTRACT

Background:

Carbapenems are the preferred β-lactamics for treatment for infections caused by enterobacteria producing extended-spectrum β-lactamases (ESBL); however, clinical studies show effectiveness of piperacillin/tazobactam in certain infections by Escherichia coli ESBL producers.

Aim:

To determine the clinical and micro-biological cure with piperacillin/tazobactam in patients with infections caused by E. coli ESBL producers, CTXM type.

Methods:

Retrospective descriptive study with adults hospitalized in a university hospital. We included urinary tract infections (UTI), intra-abdominal infections (IAI), soft tissue infections (STI) and/or bacteremia.

Results:

We studied 40 patients, where 65% corresponded to UTI, 25% to IAI and 10% were STI. The overall clinical cure was achieved in 89.4%, with the best results in the ITU (100%), followed by STI (80%) and 70% in IAI. The 85% of the strains had minimum inhibitory concentrations (MIC) ≤8 μg/ml and 70% with MIC ≤4 μg/mL, however the rate of failure were high in intra-abdominal infections with high inocula or not controlled; CTX-M-15 was found in the 62.5%.

Conclusions:

Piperacillin/tazobactam was efficient to obtain clinical and microbiological cure in patients with infections caused by ESBL producers but susceptible E. coli, especially in UTI and STI and to a lesser extent in IAI.

Key words: Extended-spectrum β-lactamase; minimum inhibitory concentration; piperacillin-tazobactam; CTX-M

Introducción

Las infecciones por enterobacterias productoras de β-lactamasas de espectro extendido (BLEE) se asocian a mayor morbilidad y mortalidad, especialmente por el retraso de una terapia adecuada y conllevan mayores costos en su atención1,2.

En el tratamiento de infecciones por enterobacterias productoras de BLEE, los carbapenémicos se han convertido en la primera opción entre los β-lactámicos, principalmente en infecciones graves. Esto se ha traducido en un incremento de las indicaciones de este grupo de antimicrobianos con un aumento proporcional no sólo en el costo económico de la terapia, sino también en la selección y emergencia de cepas resistentes a carbapenémicos35.

Se han publicado resultados positivos de cura clínica y microbiológica cuando se usa piperacilina/tazobactam en pacientes con infecciones por Escherichia coli productoras de BLEE pero sensibles (con CIM bajas) a este anti-microbiano4,5. Estos resultados podrían explicarse por una mayor actividad inhibidora de tazobactam, la que es casi 10 veces mayor que la conocida para ácido clavulánico frente a β-lactamasas tipo CTX-M, predominante a nivel mundial. Es así, que mayores cantidades de piperacilina excederían la capacidad hidrolítica de estas enzimas37.

En muchos países de Latinoamérica no se considera el uso de piperacilina/tazobactam en pacientes con infecciones por enterobacterias productoras de BLEE. Sin embargo, en Chile muchas instituciones poseen experiencia desde hace varios años con el tratamiento de pacientes con infecciones por E. coli productoras de BLEE y sensibles a este antimcrobiano8,9.

Este estudio evalúa el resultado clínico y/o microbiológico del uso de la terapia antibacteriana con piperacilina/tazobactam en pacientes con infecciones por E. coli productoras de BLEE tipo CTX-M, sensibles a este antimicrobiano, correlaciona el resultado de la terapia con piperacilina/tazobactam con las CIM y busca aportar evidencia de la eficacia de este antimicrobiano en el tratamiento de estas infecciones.

Materiales y Métodos

Diseño del protocolo

Se realizó un estudio descriptivo retrospectivo, en pacientes con infecciones por E. coli productoras de BLEE, tipo CTX-M, cepas aisladas del tracto urinario, colección intra-abdominal, piel y tejidos blandos, con o sin bacteriemia secundaria, en una institución universitaria de alta complejidad en Santiago de Chile.

Muestra

Obtenidas de pacientes hospitalizados en instituciones de la Red UC-Christus que cumplieron los criterios de inclusión y exclusión. Se recolectó la información de 40 cepas correspondientes a 38 episodios de infecciones y dos bacteriurias significativas (cultivos obtenidos previo a una biopsia renal e inicio de inmunosupresión intensa, con ciclofosfamida y corticosteroides sistémicos, respectivamente), en un período de tres años.

Criterios de inclusión

Edad ≥ 18 años, tener una infección urinaria, infección intra-abdominal, infección de piel y tejidos blandos, con o sin bacteriemia asociada, donde se aisló E. coli productora de BLEE, tipo CTX-M, sensible a piperacilina/tazobactam y que recibió tratamiento con este antimicrobiano por un mínimo de 48 h.

La dosis, intervalo de administración, tiempo de infusión y ajuste a función renal de piperacilina/tazobactam se indicaron acorde a la guía de uso de antimicrobianos del Hospital Universitario Christus-Pontificia Universidad Católica de Chile, de la siguiente manera:

Con depuración de creatinina > 50 ml/min: 4,5 g IV cada 8 h para enterobacterias, en infusión extendida por 4 h.

Con depuración entre 10-50 ml/min: 2,25 g IV cada 6 h, en infusión extendida por 4 h.

Con depuración entre < 10 ml/min: 2,25 g IV cada 8 h.

Criterios de exclusión

Pacientes hospitalizados con infecciones en otra localización, infecciones por otras enterobacterias distintas a E. coli, pacientes que recibieron otro antimicrobiano como tratamiento empírico y, finalmente, en pacientes quienes se suspendió el tratamiento con piperacilina/tazobactam, siendo sensible E. coli productora de BLEE, por indicación de su médico tratante, antes de las 48 h de su inicio, a pesar de no tener criterios de fracaso clínico. Se excluyeron también infecciones graves, para las cuales existe mayor evidencia a favor del uso de carbapenémicos como bacteriemias primarias, endocarditis infecciosa, meningitis bacteriana aguda y, en el caso de neumonía, por la dificultad de relacionar los aislados microbiológicos de la muestra respiratoria y la etiología.

Caracterización clínica

Se revisaron las fichas clínicas de los pacientes correspondientes a las cepas encontradas, tomándose los siguientes datos: edad, sexo, co-morbilidades, origen del foco infeccioso, gravedad de la infección, terapia antimicrobiana empírica inicial y definitiva. Se estableció según criterios pre-definidos, si hubo cura clínica y/o microbiológica, y se midió la mortalidad a 30 días. Se calculó además el índice de Charlson para establecer el grado de co-morbilidad de los pacientes.

Definición de infecciones según sitio, cura clínica y microbiológica

Los criterios para establecer cura clínica y/o micro-biológica según el tipo de infección fueron los sugeridos por la FDA (Food and Drug Administration: Agencia de Alimentos y Medicamentos, de los Estados Unidos de América)10:

  • Infección urinaria: pacientes con disuria, polaquiuria y / o urgencia miccional en combinación con piuria y bacteriuria, con o sin fiebre y urocultivo positivo con recuento de > 105 ufc/mL. Se consideró cura clínica a la resolución de signos y síntomas en 48-72 h de iniciado el tratamiento, sin uso de otros antimicrobianos y la cura microbiológica con urocultivo negativo después de 48 h post inicio de piperacilina/tazobactam.

  • Infección intra-abdominal (IIA): diagnóstico de absceso intra-abdominal, incluyendo absceso esplénico o hepático, apendicitis complicada por perforación o formación de abscesos, diverticulitis complicada por perforación o formación de abscesos, colecistitis con evidencia de perforación o empiema, perforación del intestino delgado o grueso con absceso o contaminación fecal, perforación de úlcera gástrica o duodenal, peritonitis acompañada de contaminación fecal. Se consideró cura clínica a la mejoría de los síntomas y/o signos atribuidos a la IIA y de la colección o colecciones intra-abdominales en el control con escanografia post-tratamiento con piperacilina/tazobactam y tratamiento quirúrgico o drenaje y se consideró fracaso clínico a la persistencia de los síntomas y/o signos atribuidos a la IIA y de la colección o colecciones intra-abdominales.

  • Infección de piel y tejidos blandos: se incluyen las infecciones de piel y tejidos (celulitis abscedada, infección de herida quirúrgica, fascitis necrosante) acompañadas de calor, eritema, induración y/o síntomas sistémicos como temperatura corporal mayor de 38°C. Se definió cura clínica a la mejoría de los síntomas inflamatorios locales entre las 48-72 h de iniciada piperacilina/tazobactam y ausencia de fiebre, seguida de una resolución clínica completa con siete o más días de tratamiento, y fracaso en caso de no mejoría clínica.

Caracterización microbiológica

Las cepas seleccionadas corresponden a pacientes atendidos entre los años 2012 y 2014, identificadas por el sistema VITEK 2 o MALDITOF y se confirmó la presencia de BLEE mediante dilución en agar según las recomendaciones de Clinical & Laboratory Standards Institute (CLSI), que considera positivo para BLEE si hay una disminución de tres veces la CIM en presencia de ceftazidima y cefotaxima con ácido clavulánico11. La determinación de la CIM de piperacilina/tazobactam se realizó por el método dilución en agar (Cathra), con las siguientes diluciones: ≤ 1, ≤ 2, ≤ 4, ≤ 8, ≤ 16, ≤ 32, ≤ 64, ≤ 128 μg/mL, según CLSI 201512.

La identificación de BLEE de los grupos 1, 2 y 9 de la familia CTX-M se llevó a cabo mediante reacción de polimerasa en cadena (RPC) utilizando los siguientes partidores F: 5' SCSATGTGCAGYACCAGTAA 3' y R: 5' CCGCRATATGRTTGGTGGTG 3', y un posterior análisis de longitud de fragmentos de restricción (RFLP) con las enzimas NheI y PstI13,14. La identificación de los alelos del grupo 1 se realizó utilizando los siguientes partidores F: 5'GGTTAAAAAATCACTGCGTC 3'15 y R: 5' ACCGTTGGTGACGATTTTAG 3'16 y las enzimas de restricción MwoI, TaqI, EagI y NruI16.

El análisis de longitud de fragmentos de restricción se realizó utilizando 14 μl de H2O libre de nucleasa, 2 μl de tampón de la enzima, 1 μl de enzima de restricción y 3 μl de producto de RPC; se incubó las muestras por 2 h a 37° C en baño termorregulado. La reacción se detuvo al agregar 3,5 μl de tampón de carga de electroforesis y se realizó una electroforesis en geles de agarosa, de acuerdo al protocolo de Laboratorio de Microbiología, sección Molecular, del Laboratorio Clínico de la Pontificia Universidad Católica de Chile.

Análisis estadístico

Para comparar los resultados entre el grupo de pacientes con mejoría clínica versus aquellos pacientes sin mejoría, se utilizará la prueba de χ2, con un nivel de significancia de 5% (p < 0,05).

Estudio aprobado por el Comité de Ética y realizado con Fondos de la Dirección de Investigación de la Escuela de Medicina de la Pontificia Universidad Católica de Chile.

Resultados

Se encontró un total de 40 pacientes con aislados de E. coli productora de BLEE, sensibles a piperacilina/tazobactam. En todas las cepas se identificó CTX-M.

Las características de los pacientes son presentadas en la Tabla 1. La mayoría de los pacientes incluidos (67%) tenían una edad mayor a 65 años. La mayoría pertenece al sexo femenino (62%), con una co-morbilidad importante evaluada con score de Charlson, mayor a 2 en 57% de ellos.

Tabla 1 Características de los pacientes (n: 40) con infecciones por Escherichia coli productoras de BLEE*. tratados con piperacilina/tazobactam 

Variable n (%)
Edad
≥ 65 años 27 (67)
Sexo
Femenino 25 (62)
Co-morbilidades
Diabetes mellitus 11 (27)
Insuficiencia cardíaca 6 (15)
Enfermedad pulmonar crónica 4 (10)
Enfermedad renal crónica 5 (12)
Hiperplasia prostática benigna 2 (5)
Daño hepático crónico 8 (20)
Neoplasia 14 (35)
Otras (ACV, hipotiroidismo, etc.) 30 (75)
Inicio de la infección
Comunitario 23 (57)
Hospitalario 17 (42)
Índice de Charlson
> 2 23 (57)
Fuente de Infección
Urinario 26 (65)
Intra-abdominal 10 (25)
Piel y tejidos blandos 4 (10)
Sepsis grave o shock séptico 18 (45)
Urinario 9 (23)
Intra-abdominal 7 (17)
Piel y tejidos blandos 2 (5)
Terapia definitiva
Piperacilina/tazobactam 26 (65)
Carbapenémicos 6 (15)
Otros: quinolonas, nitrofurantoína, cotrimoxazol, amikacina 8 (20)
Mortalidad a 30 días 0 (0)

*BLEE: β-lactamasas de espectro extendido.

Dos de ellos presentaron bacteriuria asintomática; sin embargo, se incluyeron en el estudio, pero en el grupo de cura microbiológica y no cura clínica, pues se logró una negativización del urocultivo con el uso de piperacilina/tazobactam.

El 65% de las cepas aisladas fueron de origen urinario, seguidas por el foco intra-abdominal y tejidos blandos (25 y 10%, respectivamente). El 45% de los pacientes presentaba sepsis grave o shock séptico al momento del tratamiento, de los cuales 27% correspondían a un foco urinario, 23% intra-abdominal y 5% a piel y tejidos blandos. La mayor parte de estos pacientes venían de la comunidad (57 %), pero muchos de ellos habían estados expuestos a los cuidados sanitarios por su co-morbilidad (Tabla 1).

La susceptibilidad in vitro de las cepas obtenidas fue de 100% a amikacina, imipenem y meropenem, llamando la atención entre los carbapenémicos una menor susceptibilidad a ertapenem (95,2%). También se demuestra en estas cepas susceptibilidad disminuida a nitrofurantoína, cotrimoxazol y ciprofloxacina (77, 53 y 30%, respectivamente). En todas las cepas se identificó una BLEE tipo CTX-M, siendo predominante las enzimas del grupo 1, especialmente el alelo CTX-M-15 en 62,5%. En la Tabla 3 se exhiben los resultados.

Se evaluaron los resultados según cura clínica y microbiológica observando que 100% de las infecciones de origen urinario tuvieron cura clínica y/o microbiológica, presentando una CIM a piperacilina/tazobactam ≤ 8 μg/mL en 77% de los casos. En cambio, en los focos intraabdominales y de piel y tejidos blandos la cura clínica correspondió a 70 y 80%, respectivamente, en cura clínica, a pesar que en dichos casos se presentaron CIM bajo 4 μg/ml (Tabla 2).

Tabla 2 Curación clínica y microbiológica de 40 pacientes tratados con piperacilina/tazobactam por infecciones por Escherichia coli productoras de BLEE y sus respectivas CIMs* 

Infecciones Pacientes Cura clínica Cura microbiológica CIM μg/mL (%)
n (%) n (%) n (%) ≤ 1 ≤ 2 ≤ 4 ≤ 8 ≤ 16
Urinario 26 (65%) 24/24 (100) 12/12 (100) 5 (19) 12 (46) 17 (65) 20 (77) 26 (100)
ITU alta 14 14/14 7/7 2 6 8 10 14
ITU baja 10 10/10 3/3 3 5 9 10 12
Bacteriuria asintomática 2 2/2 0 2
Intraabdominal 10 (25) 7/10 (70) 1 (10) 3 (30) 8 (80) 10 (100)
Abscesos intraabdominales 5 4/5 ND 0 2 5
Peritonitis bacteriana primaria 1 1/1 1/1 1
Peritonitis bacteriana secundaria 4 2/4 ND 1 1 3 4
Tejidos blandos 4 (10) 4/5 (80) ND 0 (0) 3 (60) 4 (80) 5 (100)
Infección de herida operatoria 4 4/4 0 2 4
Otras (Gangrena de Fournier) 1 0/1 0 0 0 0 1
Total 40 (100) 34/38 (89,4) 13/13 (100) 6 (15) 18 (45) 28 (70) 34 (85) 40 (100)

CIM: concentración inhibitoria mínima.

Tabla 3 Caracterización molecular del tipo de BLEE encontrada en Escherichia coli, según foco de infección 

Infecciones Pacientes Tipo de BLEE n (%)
n (%) CTX-M G1 CTX-M G2 CTX-M G9
M-1 M-3 M-15 M-30
Urinario 26 (65) 5 (19) 1 (4) 17 (65) 2 (8) 1 (4)
Intraabdominal 10 (25) 2 (20) 1 (10) 6 (60) 1 (10)
Tejidos blandos 4 (10) 1 (25) 2 (50) 1 (25)
Total 40 (100) 8 (20) 2 (5) 25 (62,5) 1 (2,5) 3 (7,5) 1 (2,5)

G 1: Grupo 1; G2: Grupo 2; G9: Grupo 9. No se encontraron diferencias significativas entre el origen de la infección y el tipo de BLEE.

Al comparar la cura clínica y microbiológica entre el grupo de pacientes con foco urinario y foco cutáneo y abdominal se encontraron diferencias estadísticamente significativas (p < 0,016 y p < 0,0025, respectivamente). No se encontraron diferencias entre el tipo de infección y la CIM. El promedio de días de tratamiento piperacilina/tazobactam fue de 9,3 días, siendo mayor en IIA, 13, 7 días y menor en ITU con 7,4 días.

Los fracasos clínicos correspondieron a cuatro pacientes: un paciente con absceso intra-abdominal con CTXM-1 y CIM de ≤ 2 μg/ml, dos pacientes con peritonitis bacteriana secundaria, con CTX-M-15 y CIM de ≤ 8 μg/ml y el otro con CTX-M grupo 2 con CIM de ≤ 4 μg/ml y un paciente con gangrena de Fournier, con CTX-M-15 y CIM ≤ 16 μg/ml.

Hubo tres pacientes con bacteriemias, todas secundarias a los focos estudiados. Hubo una respuesta adecuada clínica y microbiológica en aquellas de origen urinario o con peritonitis bacteriana primaria. El caso con fracaso correspondió a una peritonitis bacteriana secundaria a una perforación duodenal y, en este caso, la cepa tenía una CIM baja, ≤ 4 μg/mL. En 14 pacientes del estudio (35%) se hizo un cambio de piperacilina/tazobactam por otro antimicrobiano, en 15% a carbapenémicos y en 20% a quinolonas, cotrimoxazol y amikacina. Este cambio fue ajustado por infectología y/o médicos tratantes. En los casos que con el resultado del cultivo se prefirió el uso del carbapénemico, a pesar de la buena evolución clínica a las 48 h con piperacilina/tazobactam, se relacionó a la evidencia a favor de los primeros, en ese momento. En los otros casos el motivo fue para de-escalar a una terapia vía oral o por costo o factibilidad de terapia ambulatoria.

Discusión

Esta es la primera descripción en Chile, y posiblemente en Latinoamérica, de un estudio donde se evalúa la respuesta clínica y/o microbiológica a piperacilina/tazobactam en infecciones por E. coli productoras de BLEE tipo CTX-M, susceptible a este antimicrobiano y con una correlación con la CIM por debajo del punto de corte CLSI, lo que constituye un aporte para el enfoque de las infecciones por este microorganismo multi-resistente.

CLSI recomienda determinar la CIM de enterobacterias hasta ≤ 16 μg/mL; por lo tanto, los resultados de susceptibilidad no reportan diluciones más bajas, información que sería útil conocer para optimizar parámetros farmacodinámicos y obtener mejores resultados clínicos y microbiológicos. Previos estudios chilenos encontraron una mayor prevalencia de CTX-M-15 en E. coli, con una susceptibilidad a piperacilina/tazobactam > 80%8,17.

Algunos estudios clínicos han mostrado resultados favorables y otros no, al uso de piperacilina/tazobactam en estas infecciones; sin embargo, son de características muy distintas, por lo cual se debe ser cuidadoso al compararlos1821. Nuestro estudio mostró que piperacilina/tazobactam aparece como una alternativa exitosa en el tratamiento de pacientes con infecciones por E. coli productoras de BLEE, sensibles, tipo CTX-M. La respuesta clínica favorable en nuestros pacientes puede explicarse por la capacidad del tazobactam de inhibir las CTX-M, las que predominaron en estos estudios, además de las condiciones farmacodinámicas adecuadas en infecciones como las del tracto urinario. Estos resultados concuerdan con anteriores estudios clínicos publicados para infecciones causadas por E. coli productora de BLEE4,5. El mejor resultado se obtuvo en las infecciones de vías urinarias con mejoría en 100% de los casos; 79% de las cepas en el caso de infecciones urinarias tenían CIM ≤ 8 μg/mL. Tal vez esto explica un mayor éxito terapéutico, asociado además a un mejor control del foco infeccioso. A pesar que en las infecciones de origen intra-abdominal y de piel y tejidos blandos la mayoría tenían CIM ≤ 8 μg/mL (100 y 80%, respectivamente), los resultados clínicos no fueron mejor que en las infecciones urinarias, lo cual muestra que la localización de la infección y el efecto inoculo son fundamentales para el predecir un éxito terapéutico. El efecto del inóculo es un fenómeno que se presenta cuando la cantidad del inoculo bacteriano sobrepasa la capacidad del antibacteriano, concentraciones de 106 a 107 ufc/mL vistas en infecciones graves pueden terminar en fracaso terapéutico que, en el caso de piperacilina/tazobactam, se ha asociado a una mayor producción de BLEE en el sitio de la infección2224. Sin embargo, otros factores han sido descritos como causa de fracaso terapéutico al comparar antimicrobianos β-lactámicos/inhibidores de β-lactamasas versus carbapénemicos, además del inoculo y la CIM de piperacilina/tazobactam, como son la gravedad del cuadro clínico, la aplicación del antimicrobiano y las comorbilidades asociadas26. En nuestro estudio, a pesar que 45% llegara en sepsis grave o shock séptico, los fracasos terapéuticos se presentaron más frecuentemente en IIA, que en ITU.

Este estudio nos muestra de manera global que 85% de las cepas tienen CIM ≤ 8 μg/mL, 70% CIM ≤ 4 μg/mL, 45% CIM ≤ 2 μg/mL y 15% CIM ≤ 1 μg/mL, con una cura clínica total de 89,4%. Con estos datos podemos concluir que esta tasa de buenos resultados clínicos puede ser explicada por la CIM, pues mientras más baja se pueden obtener mejores parámetros farmacodinámicos, siempre y cuando el inóculo esté, además, controlado. Las tasas de fracaso fueron más altas en infecciones intra-abdominales, piel y tejidos blandos, posiblemente debido a ser focos con inoculo alto y no controlados. En el caso de la gangrena de Fournier, el fracaso en el tratamiento puede explicarse por tener una CIM entre > 8 y ≤ 16 μg/mL, la que es más alta que en otros fracasos. En este estudio se encontró, además, que dos de tres pacientes bacteriémicos respondieron a la terapia con piperacilina/tazobactam, aun con CIM ≤ 8 μg/mL en uno de los pacientes, en cuyos casos el control del foco fue óptimo.

No hubo mortalidad a los 30 días en este grupo de pacientes tratados.

Limitaciones del estudio fueron su carácter unicéntrico, el tamaño de la muestra pequeño y el no registrar ni la dosis, ni la forma de aplicación de piperacilina/tazobactam para evaluar diferencias entre el tipo de infección tratada y los parámetros farmacodinámicos. Además, no se evaluaron infecciones por otras enterobacterias productoras de BLEE y otros tipos de estas enzimas donde los resultados podrían ser diferentes. De hecho, la susceptibilidad de K. pneumoniae a piperacilina/tazobactam es menor que en E. coli25.

En la rutina actual de nuestros laboratorios de microbiología determinar la CIM más baja de estas enterobacterias es bastante laborioso y caro; sin embargo, la utilidad de este valor para optimizar los objetivos farmacodinámicos sería bastante útil en la práctica clínica. Además, en conjunto con una caracterización molecular del tipo de enzimas en estudios epidemiológicos, nos permitirán evaluar la evolución en cuanto a CIM, hablando específicamente de ECOFF (puntos de cortes epidemiológicos) y las BLEE presentes en las enterobacterias de nuestros pacientes. Cada región o país debe conocer el tipo de BLEE que producen las cepas de E. coli, pues hay claras diferencias en la respuesta a piperacillin/tazobactam, siendo demostrado su beneficio principalmente con la BLEE CTX-M. Llevar a cabo esta práctica día a día en los laboratorios resultaría costosa, pero por lo menos deben realizarse estudios epidemiológicos locales para responder el interrogante del tipo de BLEE predominante.

El uso de los antimicrobianos β-lactámicos/inhibidores de β-lactamasas versus carbapenémicos en el tratamiento de infecciones por enterobacterias productoras de BLEE ha conducido a varios debates y publicaciones, a favor o en contra en los últimos años2633. Muchos de estos estudios concluyen que piperacilina/tazobactam podría entonces ser una opción terapéutica útil en estas infecciones, distinta al uso de carbapenémicos. Su uso en escenarios con mejores resultados, como es el urinario, conduciría a usar menos carbapenémicos de amplio espectro, que seleccionan bacterias gramnegativas multi-resistentes como enterorabacterias con carbapenemasas, Pseudomonas aeruginosa y Acinetobacter baumannii2832.

Se recomienda el uso de las infusiones extendidas de β-lactámicos, porque aumentan la posibilidad de conseguir las concentraciones del antimicrobiano por encima de la CIM por más tiempo dentro de 24 h, T > CIM34. Estudios prospectivos y retrospectivos han demostrado mayor porcentaje de cura clínica y disminución en el tiempo de hospitalización y mortalidad con las infusiones extendidas versus intermitentes3436. Para piperacilina/tazobactam, Yusuf y cols., publicaron una revisión sistemática sobre la farmacocinética y farmacodinamia de este antimicrobiano en pacientes críticos e incluyeron un estudio aleatorizado controlado y cuatro estudios de cohorte, mostrando evidencia a favor de las infusiones prolongadas en estos pacientes versus la aplicación intermitente36.

En resumen, en nuestro estudio piperacilina/tazobactam resultó ser una alternativa terapéutica adecuada en infecciones por E. coli productoras de BLEE tipo CTX-M, susceptible a este antibacteriano, especialmente en foco urinario, de manera similar a estudios publicados en otros países. El conocimiento de la CIM más baja a piperacilina/tazobactam, el tipo de infección a tratar, el tipo de BLEE presente, la gravedad del cuadro clínico y las comorbilidades del paciente constituyen un conocimiento importante en terapéutica antimicrobiana.

Por las limitaciones de este trabajo, se necesita estudiar un mayor número de pacientes, con carácter multicéntrico, analítico, prospectivo e idealmente de asignación aleatoria, que compare el resultado clínico y/o microbiológico en los pacientes que fueron tratados con piperacilina/tazobactam y aquellos con carbapenémicos, en infecciones por E. coli productoras de BLEE, susceptibles a estos antimicrobianos y que incluya otras enterobacterias y otros tipos de β-lactamasas de espectro extendido.

Proyecto financiado por la Dirección de Investigación de la Escuela de Medicina. Pontificia Universidad Católica de Chile.

Referencias bibliográficas

1.- Stürenburg E, Mack D. Extended-spectrum β-lactamase: implications for the clinical microbiology laboratory, therapy, and infection control. J Infect 2003; 47: 273-95. [ Links ]

2.- Ramphal R, Ambrose P. Extended-spectrum β-lactamases and clinical outcomes: current data. Clin Infect Dis 2006; 42: S164-72. DOI: 10.1086/500663. [ Links ]

3.- Delgado-Valverde M, Sojo-Dorado J Pascual A, Rodríguez-Baño J. Clinical management of infections caused by multidrug-resistant Enterobacteriaceae. Ther Adv Infect Dis. 2013; 1(2): 49-69. doi: 10.1177/2049936113476284. [ Links ]

4.- Rodríguez-Baño J, Navarro M D, Retamar P, Picón E, Pascual Á; Extended-Spectrum Beta-Lactamases-Red Española de Investigación en Patología Infecciosa/Grupo de Estudio de Infección Hospitalaria Group. β-lactam/β-lactam inhibitor combinations for the treatment of bacteremia due to extended-spectrum β-lactamase-producing Escherichia coli: a post hoc analysis of prospective cohorts. Clin Infect Dis 2012; 54: 167-74. doi: 10.1093/cid/cir790. Epub 2011 Nov 4. [ Links ]

5.- Retamara P, López-Cereroa L, Muniaina M A, Pascuala A, Rodríguez-Baño J, the ESBLREIPI/GEIH Group. Impact of the MIC of piperacillin-tazobactam on the outcome of patients with bacteremia due to extended-spectrum-β-lactamase-producing Escherichia coli. Antimicrob Agents Chemother 2013; 57: 3402-4. doi: 10.1128/AAC.00135-13. Epub 2013 Apr 22. [ Links ]

6.- Bush K, Macalintal C, Rasmussen B A, Lee V J, Yang Y. Kinetic interactions of tazobactam with beta-lactamases from all major structural classes. Antimicrob. Agents Chemother 1993; 37: 851-8. [ Links ]

7.- Canton R, Coque T. The CTX-M betalactamase pandemic. Curr Opin Microbiol 2006; 9: 466-75. DOI: 10.1016/j.mib.2006.08.011. [ Links ]

8.- García C P, Rubilar P C, Vicentini H D, Román J, León C E, Muñoz C G, et al. Caracterización clínica y molecular de bacteriemias causadas por enterobacterias productoras de β-lactamasas de espectro extendido: 2004-2007. Rev Chilena Infectol 2011; 28 (6): 563-71. doi: /S0716-10182011000700009 [ Links ]

9.- García C, Astocondor L, Banda C. Enterobacterias productoras de β-lactamasas de espectro extendido: Situación en América Latina y en el Perú. Acta Méd Peruana 2012; 29 (3): 163-9. [ Links ]

10.- Guidelines for the evaluation of anti-infective drug products. http://www.fda.gov/Drugs/GuidanceComplianceRegulatoryInformation/Guidances/default.htm (accedido en mayo de 2015). [ Links ]

11.- CLSI. Performance standards for antimicrobial susceptibility testing, 24 th informational supplement. Approved standard M100-S24. Wayne, PA: CLSI, 2014. [ Links ]

12.- CLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically; Approved Standard M07-A10-Tenth Edition. Wayne, PA: CLSI, 2015. [ Links ]

13.- Cao V, Lambert T, Courvalin P. ColE1-like plasmid plP843 of Klebsiella pneumoniae encoding extended-spectrum-β-lactamase CTX-M-17. Antimicrob Agents Chemoter. 2002; 46: 1212-7. doi: 10.1128/AAC.46.5.1212-1217.2002. [ Links ]

14.- Bauernfeind A, Stemplinger I, Jungwirth R, Ernst S, Casellas J M. Sequences of β-lactamase genes encoding CTX-M-1 (MEN-1) and CTX-M-2 and relationship of their amino acid sequences with those of other β-Lactamases. Antimicrob Agents Chemother 1996; 40 (2): 509-13. [ Links ]

15.- Eckert C, Gautier V, Arlet G. DNA sequence analysis of the genetic environment of various blaCTX-M genes. J Antimicrob Chemother. 2005; 57: 14-23. https://doi.org/10.1093/jac/dki398. [ Links ]

16.- Guggiana P. Identificación de alelos de β-lactamasas de espectro extendido tipo CTX-M y su localización genética encepas de Klebsiella pneumoniae y Escherichia coli aisladas de hospitales chilenos en el período 2008 a 2011. Tesis para optar al grado de Magíster en Ciencias Mención Microbiología, 2014, Universidad de Concepción, Chile. [ Links ]

17.- Guggiana P, Domínguez M, González G, Mella S, García P, Labarca J, et al y Grupo Estudio de BLEE. Identificación y distribución de alelos de betalactamasas CTX-M grupo 1, en enterobacterias aisladas en hospitales chilenos entre los años 2008-2011. XVI Congreso Panamericano de Infectología y XXX Congreso Chileno de Infectología-Santiago, Chile;2013. http://www.sochinf.cl/documentos/2013/LIBRO_RESUMENES_api_2013.pdfLinks ]

18.- Gavin P J, Suseno M T, Thomson R B Jr, Gaydos J M, Pierson C L, Halstead D C, et al. Clinical correlation of the CLSI susceptibility breakpoint for piperacillin- tazobactam against extended-spectrum-β-lactamase-producing Escherichia coli and Klebsiella species. Antimicrob. Agents Chemother 2006; 50 (6): 2244-7. DOI: 10.1128/AAC.00381-05. [ Links ]

19.- Pérez F, Bonomo R A. Can we really use β-lactam/β-lactam inhibitor combinations for the treatment of infections caused by extended-spectrum ß-lactamase-producing bacteria? Clin Infect Dis 2012; 54 (2): 175-7. doi: 10.1093/cid/cir793 [ Links ]

20.- Tamma P D, Han J H, Rock C, Harris A D, Lautenbach E, Hsu A J, et al; Antibacterial Resistance Leadership Group. Carbapenem therapy is associated with improved survival compared with piperacillin-tazobactam for patients with extended-spectrum β-lactamase bacteremia. Clin Infect Dis 2015; 60 (9): 1319-25. doi: 10.1093/cid/civ003. [ Links ]

21.- Shiber S, Yahav D, Avni T, Leibovici L, Paul M. β-lactam/β-lactamase inhibitors versus carbapenems for the treatment of sepsis: systematic review and meta-analysis of randomized controlled trials. J. Antimicrob. Chemother 2015; 70 (1): 41-7. doi: 10.1093/jac/dku351 [ Links ]

22.- López-Cerero L, Picón E, Morillo C, Hernández J R, Docobo F, Pachón J, et al. Comparative assessment of inoculum effects on the antimicrobial activity of amoxycillinclavulanate and piperacillin-tazobactam with extended-spectrum beta-lactamase-producing and extended-spectrum beta-lactamase-non-producing Escherichia coli isolates. Clin Microbiol Infect 2010; 16 (2): 132-6. doi: 10.1111/j.1469-0691.2009.02893.x [ Links ]

23.- Thomson K S, Moland E S. Cefepime, piperacillin-tazobactam, and the inoculum effect in tests with extended-spectrum beta-lactamase-producing Enterobacteriaceae. Antimicrob Agents Chemother 2001; 45 (12): 3548-54. DOI: 10.1128/AAC.45.12.3548-3554.2001. [ Links ]

24.- Veitía J, Salgado de Velázquez J, Valery Márquez F. Combinación de antibióticos en pediatría. Archivos Venezolanos de Puericultura y Pediatría 2008; 71 (3): 96-102. [ Links ]

25.- Cifuentes-D M, Silva F, García P, Bello H, Briceño I, Calvo-Arellano M, et al. (2014). Susceptibilidad antimicrobiana en Chile. Rev Chilena Infectol 2012; 31(2): 123-30. http://dx.doi.org/10.4067/S0716-10182014000200002. [ Links ]

26.- Tamma P D, Rodríguez-Bano J. The use of noncarbapenem β-lactams for the treatment of extended-spectrum β-lactamase infections. Clin Infect Dis 2017; 64 (7): 972-80. doi: 10.1093/cid/cix034. [ Links ]

27.- Harris P N, Tambyah P A, Paterson D L. β-lactam and β-lactamase inhibitor combinations in the treatment of extended-spectrum β-lactamase producing Enterobacteriaceae: time for a reappraisal in the era of few antibiotic options? Lancet Infect Dis 2015; 15 (4): 475-85. doi: 10.1016/S1473-3099(14)70950-8. [ Links ]

28.- D'Angelo R G, Johnson J K, Bork J T, Heil E L. Treatment options for extended-spectrum beta-lactamase (ESBL) and AmpC-producing bacteria. Expert Opin Pharmacother 2016; 17 (7): 953-67. doi: 10.1517/14656566.2016.1154538. [ Links ]

29.- Gudiol C, Royo-Cebrecos C, Abdala E, Akova M, Álvarez R, Maestro-de la Calle G, et al; BICAR Study Group. Efficacy of β-lactam/β-lactamase inhibitor combinations for the treatment of bloodstream infection due to extended-spectrum-β-lactamase-producing Enterobacteriaceae in hematological patients with neutropenia. Antimicrob Agents Chemother 2017; 61 (8). pii: e00164-17. doi: 10.1128/AAC.00164-17. [ Links ]

30.- Tamma P D, Villegas M V. Use of β-lactam/β-lactamase inhibitors for extended-spectrum-β-lactamase infections: defining the right patient population. Antimicrob Agents Chemother 2017; 61 (8): pii: e01094-17. doi: 10.1128/AAC.01094-17. [ Links ]

31.- Muhammed M, Flokas M E, Detsis M, Alevizakos M, Mylonakis E. Comparison between carbapenems and β-lactam/β-lactamase inhibitors in the treatment for bloodstream infections caused by extended-spectrum β-lactamase-producing Enterobacteriaceae: A systematic review and meta-analysis. Open Forum Infect Dis 2017; 4 (2): ofx099. doi: 10.1093/ofid/ofx099. [ Links ]

32.- Palacios-Baena Z R, Gutiérrez-Gutiérrez B, Calbo E, Almirante B, Viale P, Oliver A, et al; Spanish Network for Research in Infectious Diseases (REIPI)/European Study Group of Bloodstream Infections and Sepsis (ESGBIS)/INCREMENT Group. Empiric therapy with carbapenem-sparing regimens for bloodstream infections due to extended-spectrum β-lactamase-producing Enterobacteriaceae: results from the INCREMENT Cohort. Clin Infect Dis 2017; 65 (10): 1615-23. doi: 10.1093/cid/cix606. [ Links ]

33.- Sheu CC, Lin SY, Chang YT, Lee CY, Chen YH, Hsueh PR. Management of infections caused by extended-spectrum β-lactamase-producing Enterobacteriaceae: current evidence and future prospects. Expert Rev Anti Infect Ther 2018; 1-14. https://doi.org/10.1080/14787210.2018.1436966. [ Links ]

34.- Teo J, Liew Y, Lee W, Kwa AL-H. Prolonged infusion versus intermittent boluses of β-lactam antibiotics for treatment of acute infections: a meta-analysis. Int J Antimicrob Agents 2014; 43 (5): 403-11. doi: 10.1016/j.ijantimicag.2014.01.027. [ Links ]

35.- Roberts J A, Abdul-Aziz M H, Davis J S, Dulhunty J M, Cotta M O, Myburgh J, et al. Continuous versus intermittent β-lactam infusion in severe sepsis. a meta-analysis of individual patient data from randomized trials. Am J Respir Crit Care Med 2016; 194 (6): 681-91. doi: 10.1164/rccm.201601-0024OC. [ Links ]

36.- Shiu E, Wang A M. Tejani and M. Wasdell. Continuous versus intermittent infusions of antibiotics for the treatment of severe acute infections (Review) Cochrane Database Syst Rev 2013; (3). doi: 10.1002/14651858. CD008481.pub2. [ Links ]

Recibido: 14 de Junio de 2017; Aprobado: 11 de Junio de 2018

Correspondencia a: Jaime Labarca Labarca jlabarca@med.puc.cl

Los autores declaran no tener conflictos de interés.

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.