SciELO - Scientific Electronic Library Online

 
vol.36 número3Criterios de laboratorio clínico y su utilidad como predictores del diagnóstico de síndrome cardiopulmonar por hantavirusCepas chilenas de origen clínico de Vibrio cholerae no-O1, no-O139 portan los genes vcsN2, vcsC2, vcsV2, vspD, toxR2 y vopF del sistema de secreción T3SS2 presentes en una isla de patogenicidad índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Em processo de indexaçãoCitado por Google
  • Não possue artigos similaresSimilares em SciELO
  • Em processo de indexaçãoSimilares em Google

Compartilhar


Revista chilena de infectología

versão impressa ISSN 0716-1018

Rev. chil. infectol. vol.36 no.3 Santiago jun. 2019

http://dx.doi.org/10.4067/S0716-10182019000300304 

Microbiología

Caracterización molecular y detección de genes blaCTX-M grupos 1 y 9 en Klebsiella pneumoniae resistentes a ceftazidima, en un hospital de San José de Cúcuta, Colombia

Molecular characterization and detection of genes blaCTX-M groups 1 and 9 in Klebsiella pneumoniae resistant to ceftazidime, in a hospital in San José de Cúcuta, Colombia

Fabian Galvis S.1 

Laura Moreno R.2 

1Universidad de Santander (UDES), Grupo de Investigación Biogen, San José de Cúcuta, Colombia

2Universidad Francisco de Paula Santander (UFPS), Grupo de Investigación Majumba, San José de Cúcuta, Colombia

Resumen

Introducción:

La expresión de β-lactamasas CTX-M pertenecientes a los grupos 1 y 9 en Klebsiella pneumoniae produce grados altos de resistencia a ceftazidima, y presentan una amplia distribución mundial.

Objetivo:

Identificar y caracterizar los genes blaCTX-M-Grupo1 y blaCTX-M-Grupo9 en aislados de K. pneumoniae resistentes a ceftazidima en un hospital de San José de Cúcuta, Colombia.

Material y Método:

Se diseñaron partidores para la identificación de K. pneumoniae y los genes blaCTX-M mediante reacción de polimerasa en cadena (RPC). Posteriormente se realizó el análisis de la relación genética de estos aislados por medio de la RPC basada en secuencias repetitivas (RPC-REP).

Resultados:

Treinta y ocho por ciento de los 24 aislados identificados por RPC como K. pneumoniae presentaron los genes blaCTX-M-3, blaCTX-M-15 y blaCTX-M-32 (Grupo CTX-M-1) y 42% los genes blaCTX-M14, blaCTX-M-24 y blaCTX-M-27 (Grupo CTX-M-9). El análisis filogenético agrupó los aislados de K. pneumoniae en cuatro clusters, mostrando correlación en los clusters I, II y IV, al comparar los perfiles genéticos con el tipo de muestra y grupo de genes.

Discusión:

Se encontró una frecuencia similar de los genes blaCTX-M-Grupo1 y blaCTX-M-Grupo 9 en aislados de K. pneumoniae resistentes a ceftazidima. La correlación entre la RPC-REP con los grupos de CTX-M y el tipo de muestra reveló la presencia de tres patrones clonales.

Palabras clave: blaCTX-M; ceftazidima; Klebsiella pneumoniae

ABSTRACT

Background:

The expression of CTX-M β-lactamases belonging to groups 1 and 9 in Klebsiella pneumoniae produces high levels of resistance to ceftazidime, and they have a wide distribution worldwide.

Aim:

To identify and characterize the blaCTX-M-Group1 and blaCTX-M-Group9 genes in K. pneumoniae isolates resistant to ceftazidime in a hospital in San José de Cúcuta, Colombia.

Material and Methods:

Primers were designed for the identification of K. pneumoniae and blaCTX-M genes by PCR. Subsequently, the genetic relationship of these isolates was analyzed by REP-PCR.

Results:

A 38% of the 24 isolates identified by PCR as K. pneumoniae showed blaCTX-M-3. blaCTX-M-15 y blaCTX-M-32 genes (Group CTX-M-1) and 42% blaCTX-M14. blaCTX-M-24 y blaCTX-M-27 genes (Group CTX-M-9). The phylogenetic analysis grouped the K. pneumoniae isolates into 4 clusters, showing correlation in clusters I, II and IV, when comparing the genetic profiles with the type of sample and group of genes.

Discussion:

We found a similar frequency of blaCTX-M-Group 1 and blaCTX-M-Group 9 genes in isolates of K. pneumoniae resistant to ceftazidime. The correlation between the REP-PCR with the CTX-M groups and the type of sample revealed the presence of three clonal patterns.

Keywords: blaCTX-M; ceftazidime; Klebsiella pneumoniae

Introducción

Klebsiella pneumoniae presenta un incremento considerable como agente causal de infecciones intrahospitalarias de difícil tratamiento, con afectación muy variada: tracto urinario, pulmones, tejidos blandos, área quirúrgica y sepsis; también se ha reportado un aumento en la prevalencia de K. pneumoniae resistente a antimicrobianos, entre ellos a cefalosporinas de tercera generación, provocando estancias hospitalarias prolongadas y una tasa de mortalidad de 27,3%13.

Los β-lactámicos, que incluyen las penicilinas, cefalosporinas, cefamicinas, carbapenems y monobactámicos, es un grupo de antimicrobianos utilizados para el tratamiento de las infecciones bacterianas, debido a su baja toxicidad y a su amplio espectro. La producción de enzimas β-lactamasas de espectro extendido (BLEE), que son capaces de inactivar a las cefalosporinas de espectro extendido como ceftazidima (CAZ), cefotaxima, ceftriaxona y aztreonam, han contribuido significativamente al aumento de la resistencia hacia los antibacterianos β-lactámicos. La diseminación de los genes que codifican para estas enzimas representa un problema de magnitud global, con altas tasas de producción de BLEE en algunas especies de enterobacterias como K. pneumoniae y Escherichia coli1,4.

Las BLEE se clasifican en tres tipos principales: TEM, SHV y CTX-M, donde las TEM provienen de las clásicas TEM-1 y TEM-2 contenidas en plásmidos; las SHV tienen origen cromosómico, mientras las CTX-M, de historia evolutiva distinta, presentan una actividad BLEE intrínseca movilizada desde su predecesora cromosómica en Kluyvera sp., y son las BLEE de mayor reporte mundial, predominando en agentes de infecciones nosocomiales como son E. coli y Klebsiella spp5.

Los microorganismos productores de β-lactamasas CTX-M son generalmente resistentes a la mayoría de los antibacterianos, incluidos penicilinas, cefalosporinas de espectro estrecho y oxyimino-cefalosporinas (CAZ, cefotaxima, ceftriaxona y cefepima)6,7.

La familia de las enzimas CTX-M se agrupa en base a las similitudes en las secuencias de aminoácidos en cuatro árboles filogenéticos principales: el grupo CTX-M-1 (CTX-M-1 o MEN-1, CTX-M-3, CTX-M-10, CTX-M-12, CTX-M-15 y ahora CTXM-32), el grupo CTX-M-2 (CTX-M-2, CTX-M-4, CTX-M-5, CTX-M-6, CTX-M-7, CTX-20 y Toho-1), el grupo CTX-M-8 y el grupo CTX-M-9 (CTX-M-9, CTX-M-13, CTXM-14, CTX-M-16, CTX-M-17, CTX-M-18, CTX-M-19, CTX-M-21, CTX-M-24, CTX-M-27 y Toho-2)8,9. Las enzimas CTX-M-3, CTX-M-15 y CTX-M-32 del grupo CTX-M-1, y las enzimas CTX-M-14, CTX-M-24 y CTX-M-27 del grupo CTX-M-9 están asociadas con la hidrólisis de CAZ10,11.

Las concentraciones inhibitorias mínimas (CIMs) de CAZ son altas, pero en el rango susceptible. Sin embargo, las enzimas CTX-M-15, CTX-M-16 y CTX-M-27, que albergan la sustitución Asp240Gly, confieren grados hasta ocho veces más altos de resistencia a CAZ, comparadas con sus enzimas parentales CTX-M-3, CTX-M-9 y CTX-M14, respectivamente8.

Las técnicas moleculares de tipificación de aislados de K. pneumoniae se diferencian de las técnicas fenotípicas porque pueden aplicarse a un mayor número de especies microbianas, tienen mayor poder de tipificación, son más reproducibles y tienen mayor poder de discriminación. Los principales métodos de tipificación molecular son el análisis de perfil plasmídico, el ribotipado, el análisis de endonucleasas de restricción de fragmentos, la tipificación multilocus de secuencias (MLST), la electroforesis en geles de campo pulsado (PFGE) y la reacción de polimerasa en cadena basada en secuencias repetitivas (RPC-REP). El interés de estas técnicas radica en su capacidad para establecer la relación genética (clonalidad) que existe entre aislados implicados en un brote, además de ser herramientas muy útiles para confirmar la fuente de infección o reservorio12.

Actualmente, no existen trabajos reportados en la región nor-oriental de Colombia sobre la caracterización molecular de genes blaCTX-M en aislados de K. pneumoniae resistentes a CAZ. Con el fin de contribuir al conocimiento de estas características, en este trabajo se identificaron los genes blaCTX-M, pertenecientes a los grupos 1 y 9, en aislados de K. pneumoniae. Además, se realizó un análisis de la relación genética de estos aislados utilizando (RPC-REP) como método de tipificación molecular.

Materiales y Métodos

Muestreo

Durante un período de cuatro meses se recolectaron 24 aislados de K. pneumoniae resistentes a CAZ identificados con el sistema automatizado Vitek 2 Compact de BioMérieux®. Los aislados procedían de muestras biológicas, correspondientes a muestras de orina (n: 9), muestras de sangre (n: 3), muestras de secreción bronquial (n: 6), muestras de úlceras de piel (n: 3) y una muestra de cada una de: líquido biliar, secreción de tráquea y secreción de abdomen. Las muestras provenían de pacientes atendidos en el Hospital Universitario Erasmo Meoz, Cúcuta, Norte de Santander, Colombia. La cantidad de muestras y área de recolección fueron: 7 en consulta externa (CE), 9 en urgencias (U), 4 en medicina interna (MI), 3 en UCI adultos (UCIA) y 1 en pediatría (P).

Reacción de polimerasa en cadena para la identificación de K. pneumoniae y detección de genes blaCTX-M relacionados con la resistencia a CAZ

El ADN de los aislados y el control positivo se obtuvo con el kit UltraClean® Microbial DNA Isolation de la casa comercial MoBio. En la identificación molecular de K. pneumoniae se diseñaron partidores específicos para el gen fes que expresa la proteína enteroquelina esterasa (Tabla 1). Para la identificación de los genes blaCTX-M-3, blaCTX-M-15, blaCTX-M-32 (Grupo CTX-M-1) y blaCTX-M-14, blaCTX-M-2424 y blaCTX-M-27 (Grupo CTX-M-9) relacionados con la resistencia a CAZ8,10,13,14 se diseñaron dos pares de partidores empleando herramientas de bioinformática (Tabla 1). El volumen final de la mezcla para la RPC fue de 25 μl, utilizando la enzima Taq polimerasa NZYTaq de la casa comercial Nzytech, 1 μM de cada partidor y 2 μl de ADN. Las condiciones de amplificación fueron: 95°C por 5 min para la desnaturalización inicial, seguida de 30 ciclos de 95°C por 1 min, 60°C (fes) o 58°C (blaCTX-M) por 30 s y 72°C por 1 min, y una extensión final a 72°C por 5 min. Los productos de la RPC se visualizaron en geles de agarosa al 1% teñidos con Red Safe de la casa comercial iNtRON Biotechnology.

Tabla 1 Partidores diseñados para la identificación de Klebsiella pneumoniae y genes blaCTX-M relacionados con la resistencia a CAZ mediante PCR 

Gen Partidores Tm (°C) Producto (pb)
fes KlebP_R GCTGCAACGTCTCCCCGGGA 60 908
KlebP_F GCTGTGTTGTGGTGAGTTG
Grupo 1 bla CTX-M-3 CTX-M_F1 ATGTGCAGCACCAGTAAAG
bla CTX-M-15
bla CTX-M-32 CTX-M_R1 ACCAGAATC AGCGGCGCACG 58 473
Grupo 9 bla CTX-M-14 CTX-M_F2 ATGTGCAGTACCAGTAAAG
bla CTX-M-24
bla CTX-M-27 CTX-M_R2 ACCAGAACCAGCGGCGCACG

Número de acceso a la secuencia de nucleótidos

Para el diseño de partidores para la identificación de K. pneumoniae y genes de los grupos 1 y 9 de CTX-M, mediante herramientas de bioinformática se utilizaron los siguientes números de acceso de las secuencias de nucleótidos de GenBank: CP026585.1 (gen fes), NC_010870 (CTX-M-3), NC_025019 (CTX-M-3), NC_015154 (CTX-M-15), NC_016966 (CTX-M-15), NC_021199 (CTX-M-15), NC_023332 (CTX-M-15), AJ557142 (CTX-M-32), NC_011617 (CTX-M-24), NC_016839 (CTX-M-14), NC_021078 (CTX-M-14), NC_013542 (CTX-M-14), NC_016838 (CTX-M-14) y AY156923.1 (CTX-M-27).

Caracterización molecular

Se realizó la RPC-REP utilizando el marcador MB1 (TGTACATAAGACGAAGCCC)15,16. El volumen final de la mezcla de reacción fue de 50 μL, con 200 μM de dNTPs, 2U de MyTaq ADN polimerasa de la casa comercial Bioline®, 1X del tampón de la enzima, 1 μM de cada partidor y 2 ml de ADN. La amplificación consistió en una desnaturalización inicial a 94°C por 5 min, seguidos de 32 ciclos con una desnaturalización por 1 min a 94°C, hibridación por 1 minuto a 55°C para BOX-RPC y 45°C para MB1, y polimerización por 2 min a 72°C; y una extensión final de 72°C por 7 min. Los perfiles de bandas se separaron por electroforesis en geles de agarosa al 2% por tres horas a 50 V, y teñidos con bromuro de etidio. El análisis filogenético se realizó utilizando el software CLIQS 1D PRO (TotalLab Ltd., Newcastle, UK). El análisis de agrupamiento se llevó a cabo con la técnica UPGMA utilizando el factor Dice17,18.

Resultados

En la identificación por RPC de K. pneumoniae, los 24 aislados y la cepa control K. pneumoniae ATCC® BAA-2146™ mostraron el producto esperado de 908 pb, utilizando los partidores diseñados en este estudio. En la Figura 1 se muestran 11 de los 24 aislados positivos en la RPC.

Figura 1 Identificación de K. pneumoniae. CP: Control positivo (K. pneumoniae ATCC® BAA-2146™); CN: Control negativo (K. aerogenes ATCC® 13048); K1-K11: aislados de K. pneumoniae de muestras biológicas. MM: marcador de peso molecular 1Kb DNA Ladder RTU (rango entre 250 a 10.000 pb). Se observa el fragmento esperado de ADN de 908 pb. 

Utilizando los partidores diseñados para la identificación de los genes blaCTX-M-3, blaCTX-M-15 y blaCTX-M-32 (Grupo CTX-M-1) se obtuvo amplificación en nueve aislados (38%). Para el caso de los partidores CTX-M_F2 y CTX-M_R2 diseñados para la identificación de los genes blaCTX-M14, blaCTX-M-24 y blaCTX-M-27 (Grupo CTX-M-9) se obtuvo el producto esperado en 10 aislados (42%) (Figura 2). No se observó amplificación en cinco aislados (K2, K5, K11, K13 y K20).

Figura 2 Identificación de genes blaCTXM, relacionados con la resistencia a CAZ,en aislados de K. pneumoniae. a. Partidores CTX-M_F1 y CTX-M_R1 diseñados para la identificación de los genes blaCTX-M-3. blaCTX-M-15y blaCTX-M-32 (Grupo CTX-M-1). Aislados K4, K6, K8, K9, K10, K12, K17, K18, K22 y el control positivo K. pneumoniae ATCC® BAA-2146™ presentan el producto esperado de 473 pb. b. Partidores CTX-M_F2 y CTX-M_R2 diseñados para la identificación de los genes blaCTX-M14. blaCTX-M-24y blaCTX-M-27 (Grupo CTX-M-9). Aislados K1, K3, K7, K14, K15, K16, K19, K21, K23 Y K24 presentan el producto esperado de 473 pb.CN: Control negativo de la RPC. MM: marcador de peso molecular 1 Kb DNA Ladder RTU (rango entre 250 a 10.000 pb). 

Los 24 aislados identificados como K. pneumoniae por RPC se utilizaron en la caracterización molecular con los marcadores RPC-REP, generando patrones de bandas definidas y reproducibles. Todos los aislados analizados fueron polimórficos, ya que no compartían el mismo perfil genético. Las amplificaciones presentaron un número de bandas en los aislados que varió entre tres y ocho con un tamaño aproximado de 1.600 a 50 pb. Se observaron aislados que presentaban los mismos perfiles con tres bandas compartidas (Figura 3).

Figura 3 RPC-REP de K. pneumoniae. O: orina, S: sangre, SB: secreción de bronquios, SP: úlceras de piel, LB: líquido biliar, ST: secreción de tráquea, SA: secreción de abdomen; ND: no determinado; CE: consulta externa, U: urgencias, MI: medicina interna, UCIA: UCI adultos y P: pediatría. 

El análisis filogenético mostró un índice de similitud de 0,32 para todos los aislados de K. pneumoniae, los que se agruparon en cuatro clusters; los clusters I y II agrupan cada uno seis aislados con 51 y 55 % de similitud, respectivamente; en el cluster II se presenta 100% de similitud en los aislados K9 y K18. El cluster III agrupa ocho aislados y el cluster IV agrupa cuatro aislados con 60 y 30% de similitud, respectivamente (Figura 3).

Se realizó la correlación entre los resultados de la RPC-REP con el tipo de muestra, grupo de genes blaCTX M y área de recolección de muestras (origen), encontrando una relación al comparar los perfiles genéticos con el tipo de muestra y grupo de genes. No se encontró concordancia entre el área de recolección de las muestras y el resto de información.

Discusión

Klebsiella pneumoniae causa diversas infecciones y es capaz de colonizar los intestinos, la piel y el tracto respiratorio; es un patógeno oportunista que persiste en las superficies ambientales de los hospitales y puede propagarse fácilmente por las manos de los trabajadores de la salud, lo que probablemente facilita la diseminación nosocomial14. Klebsiella pneumoniae es frecuentemente aislada en las unidades de cuidados intensivos y salas de pediatría, obteniendo cepas resistentes a cefalosporinas de tercera generación con resistencia combinada a múltiples antimicrobianos19. En Colombia, entre los años 2009 y 2012, se aisló K. pneumoniae de forma habitual en la UCI de 23 hospitales, considerándose un microorganismo endémico20.

La utilización de la RPC en laboratorios de diagnóstico para fines de rutina está en aumento, especialmente para el cribado rápido de las muestras. La RPC convencional ofrece ventajas como su alta sensibilidad, la reproducibilidad, no se requiere cultivo puro antes de la detección, permite la identificación de patógenos en diversos hospederos y tipos de muestras, y además es una técnica relativamente simple, rápida de realizar y no requiere de equipos sofisticados15. La RPC diseñada en este trabajo mostró ser efectiva en la identificación de todos los aislados de K. pneumoniae y el control positivo, logrando diferenciar la especie dentro del género.

Ceftazidima, una cefalosporina de tercera generación, ha mostrado ser activa en ensayos in vitro e infecciones clínicas causadas por bacterias gramnegativas (K. pneumoniae, Citrobacter spp, Enterobacter spp, E. coli, Haemophilus influenzae, Neisseria meningitidis, Proteus mirabilis, Proteus vulgaris, Pseudomonas spp, Serratia spp.), grampositivas (Staphylococcus aureus, Streptococcus pneumoniae, S. pyogenes, Micrococcus spp.) y anaerobios (algunas cepas de Bacteroides fragilis, Peptococcus spp, Peptostreptococcus spp, Streptococcus spp, Propionibacterium spp, Clostridium perfringens, Fusobacterium spp.). Las enzimas CTX-M confieren grados más altos de resistencia a cefotaxima que a CAZ; esta última alcanza frecuentemente una CIM en rango susceptible8. La oportuna y correcta detección de β-lactamasas tipo CTX-M en K. pneumoniae es indispensable, no sólo para lograr un adecuado tratamiento y abordaje del paciente desde el inicio, sino para establecer inmediatamente medidas de control de infecciones intrahospitalarias y evitar la diseminación de este microorganismo21. El origen de estas enzimas son los genes cromosómicos presentes en el género Kluyvera sp., que incluye especies ambientales con poca o ninguna actividad patogénica en humanos; los genes que codifican enzimas de los grupos CTX-M-1 y CTX-M-2 se han detectado en K. ascorbata, mientras que los genes que codifican enzimas de los grupos CTX-M-8 y CTX-M-9 se encuentran en K. georgiana22. Desde su identificación inicial, se han descrito más de 180 variantes alélicas, que están organizadas en al menos cinco grupos genéticamente distintos; y cada grupo está compuesto por variantes de CTX-M que contienen al menos 5% de diferencias en su secuencia de aminoácidos6. Las mutaciones puntuales que se presentan en las enzimas CTX-M comunes, producen en la mutante una mayor eficiencia catalítica frente a CAZ8.

En este trabajo se realizó la identificación molecular de genes blaCTX-M pertenecientes a los grupos 1 y 9, relacionados con la resistencia a CAZ de K. pneumoniae; nueve de los 24 aislados (38%) fueron positivos para los genes blaCTX-M-3 blaCTX-M-15 y blaCTX-M-32 (Grupo CTX-M-1), y 10 de 24 aislados (42%) amplificaron para los genes blaCTX-M14 blaCTX-M-24 y blaCTX-M-27 (Grupo CTX-M-9). Las enzimas CTX-M-15 y CTX-M-14, pertenecientes a los grupos CTX-M-1 y CTX-M-9, respectivamente, son consideradas las más importantes debido a su distribución cosmopolita y a la capacidad de invadir prácticamente todas las estructuras en humanos y animales11; diversos estudios muestran una amplia distribución mundial de los genes blaCTX-M-15 y blaCTX-M-142330.

La utilización de métodos de tipificación, para conocer la relación entre microorganismos a nivel intra o inter-específico, es de utilidad para estudios epidemiológicos de brotes y dispersión nosocomial de diversos aislados. La fenotipificación mediante perfiles de sensibilidad a antimicrobianos y los patrones de actividad metabólica, no son satisfactorios para discriminar entre los aislados. Por lo anterior, se recomienda el uso de métodos moleculares que permiten la detección rápida de relaciones clonales microbianas, controlando la propagación de patógenos resistentes a múltiples fármacos y permite el control de las medidas de control de la infección14,31.

En este estudio, el análisis de la caracterización molecular reveló variaciones en la estructura del genoma, evidenciando diversos genotipos entre los aislados de K. pneumoniae. Sin embargo, la RPC-REP permitió agrupar los aislados de acuerdo al tipo de muestras y grupo de genes blaCTX-M, lo que sugiere, probablemente, una relación clonal entre los aislados de los clusters establecidos. En el cluster 1 los seis aislados agrupados fueron identificados para los genes blaCTX-M-3, blaCTX-M-15 y blaCTX-M-32 del grupo CTX-M-1, y procedían de muestras de úlceras de pie y secreción branquial. Los aislados K9 y K18, con 100% de similitud genética, presentan el mismo tipo de muestra y área de recolección (origen), debido probablemente, a una infección nosocomial presentada en uno de los pacientes; los aislados de este cluster podrían estar clonalmente relacionados. El cluster II agrupó los aislados K3, K7 y K19 como positivos para los genes blaCTX-M14, blaCTX-M-24 y blaCTX-M-27 del Grupo CTX-M-9, con una posible relación clonal. Mientras los aislados K5, K11 y K13 no presentaban los genes CTX-M utilizados en este estudio, cuya resistencia a la CAZ se produce posiblemente, por la expresión de otras de β-lactamasas CTX-M. Los aislados K1, K23 y K24 del cluster IV, aunque se agrupan con un porcentaje bajo de similitud (50%), es posible que tengan un origen común ya que fueron positivos para los genes blaCTX-M14, blaCTX-M-24 y blaCTX-M-27 del Grupo CTX-M-9 y provienen del mismo tipo de muestra.

Resultados similares han sido reportados por otros autores, utilizando la RPC-REP para establecer la relación clónica de diversos aislados de K. pneumoniae y su correlación con variables fenotípicas, bioquímicas y genéticas3234. López y cols. (2018), lograron discriminar dos patrones clonales en aislados de K. pneumoniae mediante RPC-REP, generando una relación clonal a partir de 60% de similitud entre los aislados35. En un trabajo realizado por Low y cols. (2017), la RPC-REP permitió agrupar en un cluster principal la mayoría de los aislados de K. pneumoniae caracterizados como resistentes a carbapenem36. Koroglu y cols., en el año 2015 realizaron un estudio para establecer las relaciones clónicas de 15 aislados de K. pneumoniae empleando RPC-REP y PFGE como métodos de tipificación, concluyendo que el método RPC-REP era claramente más rápido y conveniente que PFGE, pero su poder discriminatorio parece ser inferior al de PFGE14. En otro trabajo, Ardalan y cols. (2016), emplearon la RPC-REP para demostrar que no todas las especies que producen CTX-M se originan del mismo aislado y que los genes de resistencia se han extendido entre diferentes cepas; además lograron agrupar los perfiles genéticos relacionados con diferentes factores de riesgo37. Nielsen y cols. compararon en el 2011, el poder discriminatorio entre la RPC-REP con la PFGE y MLST en aislados de K. pneumoniae, demostrando que la RPC-REP puede utilizarse como un método de tipificación rápido y menos costoso que PFGE y MLST, lo que permite la diferenciación de clones, así como también la posibilidad de agruparlos de acuerdo a la producción de diversas β-lactamasas38. En este estudio, el cluster III mostró una similitud de 60% en los ocho aislados, sin presentar relación con el tipo de muestra y grupo CTX-M. Lo anterior se relaciona con lo obtenido por Ghasemian y cols. (2018), quienes reportan que el patrón de tipificación de RPC-REP de aislados K. pneumoniae mostró una gran diversidad, lo que indica la propagación policlonal de aislados productores de diferentes grupos de CTX-M39.

La caracterización bioquímica de los mecanismos de resistencia y la tipificación molecular son herramientas útiles para estudios epidemiológicos y para conocer el comportamiento de las poblaciones bacterianas, de procesos específicos relacionados con la infección intrahospitalaria y las características de la resistencia a antimicrobianos en la institución, permitiendo al ente hospitalario encargado aplicar medidas oportunas, orientadas a optimizar los esfuerzos en el control de infecciones y a evitar su progresión y propagación.

Finalmente, es importante destacar que los resultados de esta investigación son el primer reporte que se presenta en la región nor-oriental de Colombia sobre la descripción de genes blaCTX-M en aislados de K. pneumoniae, tomados a partir de diferentes muestras clínicas en un hospital de la ciudad de San José de Cúcuta, mostrando una frecuencia similar en los dos grupos, 38% para los genes blaCTX-M-3, blaCTX-M-15 y blaCTX-M-32 (Grupo 1) y 40% para los genes blaCTX-M14, blaCTX-M-24 y blaCTX-M-27 (Grupo 9). Estos datos soportan la estadística epidemiológica que describen los genes identificados en este estudio, como los más comunes a nivel mundial. La RPC-REP permitió agrupar 12 aislados por la similitud de sus perfiles genéticos, los que se relacionaron con los grupos 1 y 9 de CTX-M y el tipo de muestra, revelando la presencia de tres patrones clonales. Los 12 aislados restantes no presentaron una relación homogénea entre la tipificación genética y grupo de genes y clase de muestra. Es posible, que estos aislados con perfiles genéticos diferentes correspondan a aislados con cromosomas muy parecidos, que han adquirido elementos extra-cromosómicos determinantes de patrones electroforéticos diferentes con el sistema RPC-REP. Esta diferencia sugiere la necesidad de utilizar, por lo menos, dos marcadores diferentes para lograr establecer con mayor eficacia las posibles relaciones genéticas y epidemiológicas entre aislamientos.

Conclusiones

La RPC diseñada para discriminar los grupos CTX-M-1 y CTX-M-9 en K. pneumoniae, determinó una presencia proporcional de los dos grupos de genes en 80% de la población analizada; la posterior correlación entre los perfiles genéticos y los resultados de identificación de genes blaCTX-M sugieren que 12 de los 24 aislados incluidos en este estudio, posiblemente son producto de la diseminación de tres clones diferentes.

La presencia de genes blaCTX-M-Grupo1 y blaCTX-M-Grupo 9 detectados en los aislados obtenidos a nivel hospitalario, que confieren una resistencia o susceptibilidad reducida a CAZ, podría evidenciar la aparición de un alto porcentaje de poblaciones resistentes a esta cefalosporina convirtiéndose en una grave amenaza para el manejo clínico de las infecciones, lo que hace de este trabajo un aporte importante para generar estrategias de prevención y retraso de resistencia en la aplicación de antimicrobianos.

Financiamiento interno UDES y UFPS.

Referencias bibliográficas

1.- Schill F, Abdulmawjood A, Klein G, Reich F. Prevalence and characterization of extendedspectrum β-lactamase (ESBL) and AmpC β-lactamase producing Enterobacteriaceae in fresh pork meat at processing level in Germany. Int J Food Microbiol 2017; 257: 58-66. doi: https://doi.org/10.1016/j.ijfoodmicro.2017.06.010. [ Links ]

2.- Echeverri L, Cataño J. Klebsiella pneumoniae como patógeno intrahospitalario: epidemiología y resistencia. Latreia 2010; 23(3): 240-9. Disponible en: http://www.redalyc.org/html/1805/180518994006/Links ]

3.- Bello H, Trabal N, Ibáñez D, Reyes A, Domínguez M, Mella S, et al. β-Lactamasas de familias diferentes a TEM y SHV en cepas de Klebsiella pneumoniae subespecie pneumoniae aisladas en hospitales chilenos. Rev Med Chile 2005; 133 (6): 737-9. doi: http://dx.doi.org/10.4067/S0034-98872005000600018. [ Links ]

4.- Arce Z, Alarcón E, Limo J, Llontop J, Valle, J. Detección de genes shv y tem en cepas de Escherichia coli productoras de β-lactamasas de espectro extendido procedentes de dos centros hospitalarios de Chiclayo-Perú: eneroagosto 2011. Rev Cuerpo Méd HNAAA 2012; 5 (3): 13-6. Disponible en: https://dialnet.unirioja.es/servlet/articulo?codigo=4040370. [ Links ]

5.- Rivera M, Rodríguez C, Flores R, Serquén L, Arce Z. Betalactamasas de espectro extendido tipo TEM y CTX-M en Klebsiella spp y Escherichia coli aisladas de superficies de ambientes hospitalarios. Rev Peru Med Exp Salud Publica 2015; 32: 752-755. Disponible en: https://www.scielosp.org/pdf/rpmesp/2015.v32n4/752-755/esLinks ]

6.- Ghiglione B, Rodríguez M, Curto L, Brunetti F, Dropa M, Bonomo R, et al. Defining substrate specificity in the CTX-M family: the role of Asp240 in ceftazidime hydrolysis. Antimicrob Agents Chemother 2018; 62 (6):e00116-18. doi: http://dx.doi.org/10.1128/AAC.00116-18. [ Links ]

7.- Navarro F, Calvo J, Cantón R, Fernández-Cuenca F, Mirelis B. Detección fenotípica de mecanismos de resistencia en microorganismos gramnegativos. Enferm Infecc Microbiol Clin 2011; 29 (7): 524-34. doi: https://doi.org/10.1016/j.eimc.2011.03.011. [ Links ]

8.- Bonnet R. Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother 2004; 48 (1): 1-14. doi: 10.1128/AAC.48.1.1-14.2004 [ Links ]

9.- Cartelle M, del Mar M, Molina F, Moure R, Villanueva R, Bou G. High-level resistance to ceftazidime conferred by a novel enzyme, CTX-M-32, derived from CTX-M-1 through a single Asp240-Gly substitution. Antimicrob Agents Chemother 2004; 48(6): 2308-13. doi: https://doi.org/10.1128/AAC.48.6.2308-2313.2004. [ Links ]

10.- Tarlton N, Satoorian T, Panchal A, Borges C, Geisberg M and Riley L. Monoclonal antibody-mediated detection of CTX-M β-lactamases in Gram-negative bacteria. J Microbiol Methods 2018; 144: 37-43. doi: https://doi.org/10.1016/j.mimet.2017.09.017. [ Links ]

11.- Cantón R, González J, Galán J. CTX-M enzymes: origin and diffusion. Front. Microbiol 2012; 3: 1-19. doi: https://doi.org/10.3389/fmicb.2012.00110. [ Links ]

12.- Cuenca F, Cerero L, Hernández A. Técnicas de tipificación molecular para la vigilancia y control de la infección. Enferm Infecc Microbiol Clin 2013; 31: 20-5. Disponible en: https://www.seimc.org/contenidos/ccs/revisionestematicas/microbiologiamolecular/ccs-2011-microbmolecular1.pdf. [ Links ]

13.- Costa J, Stein C, Pfeifer Y, Brandt C, Pletz M and Makarewicz O. Mutagenesis of the CTX-M-type ESBL-is MIC-guided treatment according to the new EUCAST recommendations a safe approach? J Antimicrob Chemother 2015; 70 (9): 2528-35. doi: https://doi.org/10.1093/jac/dkv153. [ Links ]

14.- Koroglu M, Ozbek A, Demiray T, Hafizoglu T, Guclu E, Altindis M, et al. Investigation of clonal relationships of K. pneumoniae isolates from neonatal intensive care units by PFGE and rep-PCR. J Infect Dev Ctries 2015; 9 (08): 829-36. doi: https://doi.org/10.3855/jidc.6326. [ Links ]

15.- Galvis F, Carrillo M. Identificación y caracterización molecular de aislados de Burkholderia glumae: agente causante del añublo bacterial en el cultivo de arroz. Inf tecnol 2015; 26(3): 33-40. doi: http://dx.doi.org/10.4067/S0718-07642015000300006. [ Links ]

16.- Brumlik M, Bielawska-Drozd A, Zakowska D, Liang X, Spalletta R, Patra G, et al. Genetic diversity among Bacillus anthracis, Bacillus cereus and Bacillus thuringiensis strains using repetitive element polymorphism-PCR. Pol J Microbiol 2004; 53 (4): 215-25. Disponible en: http://www.pjmonline.org/wp-content/uploads/archive/vol5342004215.pdf. [ Links ]

17.- Skowron K, Sękowska A, Kaczmarek A, Grudlewska K, Budzyńska A, Białucha A, et al. Comparison of the effectiveness of dipping agents on bacteria causing mastitis in cattle. Ann Agric Environ Med 2019; 26 (1): 39-45. doi: https://doi.org/10.26444/aaem/82626. [ Links ]

18.- Mikucionyte G, Zamorano L, Vitkauskiene A, López-Causapé C, Juan C, Mulet X, et al. Nosocomial dissemination of VIM-2-producing ST235 Pseudomonas aeruginosa in Lithuania. Eur J Clin Microbiol Infect Dis 2016; 35: 195-200. doi: https://doi.org/10.1007/s10096-015-2529-0. [ Links ]

19.- González A, Nieves B, Solórzano M, Cruz J, Puig J y Moreno M. Caracterización de cepas de Klebsiella pneumoniae productora de β-lactamasa de espectro extendido aisladas en dos unidades de cuidados intensivos. Rev Chilena Infectol 2013; 30 (4): 374-80. doi: http://dx.doi.org/10.4067/S0716-10182013000400004. [ Links ]

20.- Bustos G, Josa D, Perea J, Gualtero S, Ortiz J, Novoa A, et al. Factores relacionados con el control exitoso de un brote por Klebsiella pneumoniae productora de KPC-2 en una unidad de cuidado intensivo en Bogotá, Colombia. Infectio 2016; 20 (1): 25-32. doi: https://doi.org/10.1016/j.infect.2015.07.001. [ Links ]

21.- Toro L, Muñoz S, Restrepo J. K. pneumoniae y betalactamasas. Un problema creciente. Medicina UPB 2009; 28(2): 135-41. Disponible en: https://revistas.upb.edu.co/index.php/Medicina/article/view/453/400Links ]

22.- Lartigue M, Poirel L, Aubert D, Nordmann P. In vitro analysis of ISEcp1B-mediated mobilization of naturally occurring β-lactamase gene blaCTX-M of Kluyvera ascorbata. Antimicrob. Agents Chemother 2006; 50 (4): 1282-6. doi: https://doi.org/10.1128/AAC.50.4.1282-1286.2006. [ Links ]

23.- Cha M, Kang C, Kim S, Chung D, Peck K, Lee N, Song J. High prevalence of CTX-M-15-type extended-spectrum β-lactamase among AmpC β-lactamase-producing Klebsiella pneumoniae isolates causing bacteremia in Korea. Microb Drug Resist 2018; 24 (7): doi: https://doi.org/10.1089/mdr.2017.0362. [ Links ]

24.- Compain F, Dorchène D and Arthur M. Combination of amino acid substitutions leading to CTX-M-15-mediated resistance to the ceftazidime-avibactam combination. Antimicrob. Agents Chemother 2018; 62 (9):e00357-18. doi: https://doi.org/10.1128/AAC.00357-18. [ Links ]

25.- Lee M, Ko K, Kang C, Chung D, Peck K, Song J. High prevalence of CTX-M-15-producing Klebsiella pneumoniae isolates in Asian countries: diverse clones and clonal dissemination. Int J Antimicrob Agents 2011; 38(2): 160-3. doi: https://doi.org/10.1016/j.ijantimicag.2011.03.020. [ Links ]

26.- Conceicao T, Brizio A, Duarte A, Lito L, Cristino J, Salgado M. First description of CTX-M-15-producing Klebsiella pneumoniae in Portugal. Antimicrob. Agents Chemother 2005; 49 (1): 477-8. doi: https://doi.org/10.1128/AAC.49.1.477-478.2005. [ Links ]

27.- Moubareck C, Daoud Z, Hakimé N, Hamzé M, Mangeney N, Matta H, et al. Countrywide spread of community-and hospital-acquired extended-spectrum β-lactamase (CTX-M-15)-producing Enterobacteriaceae in Lebanon. J Clin Microbiol 2005; 43 (7): 3309-13. doi: https://doi.org/doi:10.1128/JCM.43.7.33093313.2005. [ Links ]

28.- Pitout J, Hossain A, Hanson N. Phenotypic and molecular detection of CTX-M-β-lactamases produced by Escherichia coli and Klebsiella spp. J Clin Microbiol 2004; 42(12): 5715-21.doi: https://doi.org/10.1128/JCM.42.12.57155721.2004. [ Links ]

29.- Edelstein M, Pimkin M, Palagin I, Edelstein I, Stratchounski L. Prevalence and molecular epidemiology of CTX-M extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in Russian hospitals. Antimicrob. Agents Chemother 2003; 47 (12): 3724-32. doi: https://doi.org/10.1128/AAC.47.12.3724-3732.2003. [ Links ]

30.- Yu W, Winokur P, Von Stein D, Pfaller M, Wang J, Jones R. First description of Klebsiella pneumoniae harboring CTX-M β-lactamases (CTX-M-14 and CTX-M-3) in Taiwan. Antimicrob. Agents Chemother 2002; 46(4): 1098-100. doi: https://doi.org/10.1128/AAC.46.4.1098-1100.2002. [ Links ]

31.- Vásquez M, Correa M, Estrada J, Castañeda L, Moreno M. Caracterización fenotípica y determinación del perfil de bandas plasmídicas de Klebsiella pneumoniae multirresisitente aisladas de diferentes centros hospitalarios de Medellín, Colombia. Actual Biol 2003; 25(79): 119-29. Disponible en: http://aprendeenlinea.udea.edu.co/revistas/index.php/actbio/article/view/329492/20785930. [ Links ]

32.- Hasan C, Turlej-Rogacka A, Vatopoulos A, Giakkoupi P, Maatallah M, Giske C. Dissemination of blaVIM in Greece at the peak of the epidemic of 2005–2006: clonal expansion of Klebsiella pneumoniae clonal complex 147. Clin Microbiol Infect 2014; 20 (1): 34-7. doi: https://doi.org/10.1111/14690691.12187. [ Links ]

33.- Zowawi H, Sartor A, Balkhy H, Walsh T, Al Johani S, AlJindan R, et al. Molecular characterization of carbapenemase-producing Escherichia coli and Klebsiella pneumoniae in the countries of the Gulf cooperation council: dominance of OXA-48 and NDM producers. Antimicrob. Agents Chemother 2014; 58 (6): 3085-90. doi: https://doi.org/10.1128/AAC.02050-13. [ Links ]

34.- Iraz M, Özad A, Sandallı C, Doymaz M, Akkoyunlu Y, Saral A, et al. Distribution of β-lactamase genes among carbapenem-resistant Klebsiella pneumoniae strains isolated from patients in Turkey. Ann Lab Med 2015; 35 (6): 595-601. doi: https://doi.org/10.3343/alm.2015.35.6.595. [ Links ]

35.- López K, Díaz K, Espinoza M, Santamaría O, Serquén L, Canelo O, et al. Patrón de clonalidad mediante ERIC-PCR y REP-PCR de Escherichia coli y Klebsiella pneumoniae productores de betalactamasas de espectro extendido, aisladas de pacientes con infección urinaria intrahospitalaria. Hospital Regional Lambayeque, Perú. Horiz Med 2018; 18 (2): 11-8. doi: http://dx.doi.org/10.24265/horizmed.2018.v18n2.03. [ Links ]

36.- Low Y, Yap I, Jabar K, Yusof M, Chong C and Teh C. Genotypic and metabolic approaches towards the segregation of Klebsiella pneumoniae strains producing different antibiotic resistant enzymes. Metabolomics 2017; 13(5): 65. doi: https://doi.org/10.1007/s11306-017-1201-3. [ Links ]

37.- Ardalan N, Jamaran S, Memari F, Davari K, Rostami B and Ramazanzadeh R. Risk factors associated with community-acquired CTX-M producing Klebsiella pneumoniae typing by Rep-PCR in Sanandaj, Iran. Biotech Res Asia 2016; 13 (3): 1311-7. doi: http://dx.doi.org/10.13005/bbra/2271. [ Links ]

38.- Nielsen J, Skov M, Jørgensen R, Heltberg O, Hansen D and Schønning K. Identification of CTX-M15-, SHV-28-producing Klebsiella pneumoniae ST15 as an epidemic clone in the Copenhagen area using a semi-automated Rep-PCR typing assay. Eur J Clin Microbiol Infect Dis 2011; 30 (6): 773-8. doi: https://doi.org/10.1007/s10096-011-1153-x. [ Links ]

39.- Ghasemian A, Shafiei M, Eslami M, Vafaei M, Nojoom F and Rajabi-Vardanjani H. Molecular typing of Klebsiella pneumoniae isolates using repetitive extragenic palindromic sequence-based PCR in a Hospital in Tehran, Iran. Int J Enteric Pathog 2018; 6 (1): 27-30. doi: https://doi.org/10.15171/ijep.2018.07. [ Links ]

Recibido: 15 de Julio de 2018; Aprobado: 22 de Marzo de 2019

Correspondencia a: Fabian Galvis Serrano fgs999@hotmail.com.

Los autores del presente trabajo declaramos que no existe ningún potencial conflicto de interés relacionado con el artículo.

Creative Commons License This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.