Cloning and comparison of ten gene sequences of a
Chilean H. pylori strain with other H. pylori strains
revealed higher variability for VacA and CagA virulence factors

ILSE MÜLLER,¹ ANGELICA MEDINA-SELBY,² JOSE LUIS PALACIOS,³ PATRICIO MARTINEZ,³ PATRICIO OPAZO,³ ELSA BRUCE,³ MARTA MANCILLA,¹ PABLO VALENZUELA,¹ ARTURO YUDELEVICH¹ AND ALEJANDRO VENEGAS ³

¹BIOS Chile IGSA y MIFAB, Avda Marathon 1942, Santiago, Chile
²Chiron Corporation, Emeryville, CA 94608 USA
³Departamento de Genética Molecular y Microbiología, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Alameda 340, Santiago, Chile

Corresponding autor: Alejandro Venegas. Departamento de Genética Molecular y Microbiología. Facultad de Ciencias Biológicas. Pontificia Universidad Católica de Chile, Alameda 340, Santiago, Chile. e-mail: avenegas@genes.bio.puc.cl. Telephone: (56-2)686-2661. Fax: (56-2)222-2810

Received January 30, 2002. Accepted March 11, 2002

 

ABSTRACT

We have cloned and sequenced ten Helicobacter pylori genes from a Chilean strain (CH-CTX1) including: a cytotoxin VacA fragment, a CagA fragment (A17), a species-specific protein (TsaA), urease subunits (UreA, UreB), a flagellin subunit (FlaB), heat shock proteins (HspA and HspB), adhesin (HpaA) and a lipoprotein (Lpp20). We compared their deduced amino acid sequences with the corresponding sequences from three unrelated H. pylori strains, including fully sequenced strains 26695(UK) and J99(USA), and found that eight of them (UreA, UreB, FlaB, HspA, HspB, Lpp20, TsaA and HpaA) presented more than 97.3% identity. In contrast, VacA partial sequence showed lower identity values (93.2 - 94.9%). Moreover, we found major differences in the A17 region respect to the number and arrangement of the internal repeated elements when sequences from different strains were aligned. The A17 regions from strains CH-CTX1 and 26695 are very similar (91.8% identity) but lacked 6 repeated elements when compared to the Australian strains ATCC 43526 and NCTC 11637. The CCUG 17874 A17 region showed the largest deletion involving 9 repeats. A17 size differences between strains CCUG 17874 and CH-CTX1 were verified by PCR and polypeptide size. Such differences may explain variations in virulence among H. pylori strains as well as diversity in serum immunoreactivity.

Key terms: Chilean H. pylori strain, PCR-cloned genes, HpaA, VacA, and CagA sequences.

 

INTRODUCTION

Helicobacter pylori infections have been associated with various diseases of the gastric epithelium such as gastritis, peptic ulcerations and gastric adenocarcinoma (Marshall and Warren 1984, Graham et al., 1988; Parsonnet et al., 1991). It is estimated that 60% of the world's population is infected with H. pylori, ranging from 20-30 % in developed countries up to 70- 80% in developing countries (Graham et al., 1987; Dooley et al., 1989; Perez-Perez et al., 1990; Sitas et al., 1991; Figueroa et al., 1993).

Despite these high rates of infection, only a subset of individuals develops ulcer disease or gastric cancer. The reason for this is unknown, but probably host genetics, environmental factors and the presence of strain-specific genetic diversity play a role in the development of clinical diseases.

It has been shown by various molecular methods, such as restriction fragment length polymorphism analysis, ribotyping, PCR-based RAPD fingerprinting and PFGE (Akopyants et al. 1992a; Akopyants et al., 1992b; Taylor et al., 1992 and Tee et al., 1992) that H. pylori strains show a high degree of diversity at the genetic level, with virtually every isolate showing a different restriction pattern or ribotype. Despite this, several reports have demonstrated through the use of DNA sequencing that such nucleotide variability does not translate into highly divergent proteins. This is explained mainly by the fact that substitutions generally occur at the third-base position of the codons (Evans et al., 1995). Indeed, in a recent comparison of two genome sequences of unrelated strains (J99 and 26695 isolated in the USA and UK, respectively), the predicted proteins encoded by both genomes were found to be quite similar (Alm et al., 1999), indicating that most phenotypic characteristics are well conserved, as previously shown (Goodwin et al., 1989; McNulty et al., 1987; Taylor et al., 1987 and Perez-Perez et al., 1987). However, confirmation of these findings requires more extensive sequence analysis of H. pylori strains of different geographic origins, especially from developing countries where information is rather scarce.

Two exceptions to this H. pylori phenotypic homogenicity are currently recognized. First, about 50 to 60 % of H. pylori strains produce a vacuolating cytotoxin, VacA (Cover et al. 1992; Blaser, 1996), although the vacA gene is always present as reported in isolates from infected Irish patients (Dundon et al., 2000). Second, there is heterogenicity among strains regarding the production of an antigenic protein of 120 to 128 kDa, called CagA (Covacci et al., 1993, Tummuru et al., 1993). The function of this protein remained unknown for considerable time, and only recently has a function for this protein been proposed: CagA is translocated into epithelial gastric cells, and once inside the cells, the protein is phosphorylated at tyrosine residues by an unknown cellular tyrosine kinase. Phosphorylated CagA is able to interfere with signal transduction pathways promoting proinflammatory and proliferative processes (Segal et al., 1999). Furthermore, proteolytic processing of CagA generates a 45-55 kDa phosphorylated product when bacteria are captured by professional phagocytes. This processed product corresponds to the CagA C-terminus region (Odenbreit et al., 2001) suggesting that phosphorylated residues are in this region. Infection with H. pylori strains expressing CagA and VacA has been associated with patients with duodenal ulcer or gastric cancer in the USA and Germany (Figura et al., 1989; Miehlke et al., 2000). This finding has been controversial, since reports from Asia have not found such correlation (Mitchell et al., 1996.; Kodama et al., 1996; Park et al., 1998). Recently, we observed that antibodies raised against VacA and CagA are not suitable markers for either duodenal ulcer or gastric cancer in the Chilean population (Opazo et al., 1999). These discrepancies and other findings led us to the idea that there are several distinct forms of CagA and VacA in H. pylori isolated from different geographic areas. At present, allelic variants for both proteins have been described. VacA presents allelic variations at N-terminal region (s1a, s1b and s2) and near the middle region (m1 and m2), which account for the differences in the cytotoxin production or vacuolating activity, as the strains with the s1m1 combined alleles the highest VacA producers (Atherton et al., 1995). Moreover, VacA s and m regions seem to have different clinical relevance; for instance s1a/m1 allele is frequently associated with major gastric epithelial damage and duodenal ulcer (Atherton et al., 1995; Van Doorn et al., 1998). Additionally, 14 different alleles detected by restriction analysis have been reported for the VacA C-terminus region in a Taiwanese population (Wang et al., 1998). Recently, a new functional activity for VacA was revealed (Tombola et al. 2001), showing that VacA promotes urea diffusion across epithelia. Variations in this activity may affect bacterial growth and virulence.

With respect to CagA, a variable region with repeated elements that accounts for strain-to-strain size variation of CagA has been reported (Covacci et al., 1993; Evans et al., 1998), but the function of such a variable region is far from being understood.

The aim of the present report was to genetically characterize a Chilean cytotoxic H. pylori strain by DNA sequence analysis of ten representative genes, including well-conserved and virulence-related genes, to compare their deduced amino acid sequences with the corresponding sequences obtained from the two fully-sequenced genomes, as well as others from unrelated strains. We propose that in contrast to several well-conserved sequences, divergence of VacA alleles and size variation found in the A17 region of the cagA gene may explain variability in strain virulence, growth capability and simultaneously contribute to differences in antigenic immunoreactivity of the encoded proteins.

 

MATERIALS AND METHODS

Plasmids, bacterial strains and growth conditions. Plasmid vectors pET3b, pET11b and pET21a (Studier, 1990) and E. coli BL21(DE3) cells were obtained from Novagen, Madison, Wisconsin, USA. The vector pKK233-2 was obtained from Pharmacia Biotech, Uppsala, Sweden. H. pylori strain 26695 was provided by Dr. G. Perez-Perez. CH-CTX1, a Chilean Cag+VacA+ strain, was isolated from a duodenal ulcer patient (Opazo et al., 1999). Plasmid pEX34b.HP17/12 carrying the A17 fragment of the cagA gene from strain CCUG 17874 (it-A17 gene) was kindly provided by Dr. A. Covacci. The it-A17 gene was subcloned in DH5a cells after ligation into the vector pKK233-2 using the NcoI and HindIII sites of the polylinker region.

Preparation of chromosomal and plasmid DNAs. Chromosomal DNA was obtained according to Covacci et al., 1993, from an H. pylori Chilean strain (CH-CTX1). Briefly, bacterial cells were centrifuged from overnight cultures, resuspended in STE buffer (0.1 M NaCl, 10 mM Tris HCl, 1 mM EDTA, pH 8.0) and incubated at 25°C for 5 min. Cells were lysed with 1% sodium dodecyl sulfate (SDS) by heating at 65°C for 30 min. Proteins were removed by digestion with 25 µg/ml proteinase K for 2 hours at 50°C, followed by two phenol-chloroform (1:1) extractions, one chloroform-isoamyl alcohol (24:1) extraction, and the DNA was finally isolated by ethanol precipitation. Plasmid DNA was purified by alkaline lysis (Sambrook et al., 1989) or using the Qiagen kit (Chatsworth, CA, USA).

Competents cells, DNA manipulations and transformation. Preparation of competent E. coli BL21(DE3) cells, DNA ligations and transformations were done according to Sambrook et al., (1989).

Polymerase chain reactions and DNA agarose electrophoresis. General protocols were taken from Saiki (1990). Primers (50 pmol each) were used in a 100 microliter final volume for the different genes as listed in Table I. PCR templates were chromosomal CH-CTX1 DNA (100 ng per reaction) to amplify the 10 listed genes and plasmid pEX34b.HP17/12 (50 ng) for amplification of the it-a17 gene region from CCUG 17874 strain. Plasmid constructions and visualizations of PCR amplifications were analyzed by horizontal agarose gel electrophoresis in TAE buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.3).

Gel electrophoresis for proteins and Western blots. SDS-PAGE (SDS-polyacrylamide gel electrophoresis) was done following the Laemmli procedure (1970). Western blots were carried out according to Towbin et al. (1979) with minor changes, using a miniblot system. Briefly, filters were blocked overnight at 4oC with 5% nonfat milk in TBS (150 mM NaCl, 10 mM Tris-HCl, pH 8.0). Filters were incubated with human serum antibodies (diluted 1:200) selected from a sera panel of infected patients with increased immunoreactivity toward the analyzed gene products and in some cases using a monoclonal antibody prepared against A17 truncated product from the CH-CTX1 strain. The incubation was for 3 hours at 25oC followed by 3 washes with TBS for 5 min each. The filters were then incubated for 1 hour with anti-human IgG conjugated to alkaline phosphatase, diluted 1:1000 in TBS with 5% nonfat milk. In the case of A17 monoclonal antibody a 1:1000 dilution of the corresponding anti-mouse IgG was used. The washed filters were revealed with 82.5 µl of 50 mg/ml BCIP (5-Bromo-4-chloro-3-indolyl phosphate) and 125 µl of 50 mg/ml NBT (nitro blue tetrazolium chloride) in 25 ml of alkaline phosphatase buffer (0.1 M Tris-HCl, 0.1 M NaCl, 5 mM MgCl₂, pH 9.5).

TABLE I

Sequence of primers for PCR amplification of different H. pylori antigen genes

Primer a	DNA sequence b 5' -> 3'	Restriction sitesc
A17-EC-1	AGATCT CATATG GAATTC AAAAATGGCAAAAATAAGGATTTCAGCAAGGTA	BglII, NdeI, EcoRI
A17-EC-2	AGATCT AAGCTTCTATTA TTCTGATACCGCTTGATTGAGATTGTCAATTTTCTG	BglII, HindIII
AG26-BN	TGCGGATCCATATG TTAGTTACAAAACTTGCCCCCGATTTT	BamHI, NdeI
AG26-EH	CGAATTC AAGCTTCTATTA AATGGAATTTTCTTTAAGATATTCTGC	EcoRI, HindIII
UreA-BN	GAGTGCGGATTC CATATG AAACTCACCCCAAAAGAGTTAGACAAG	EcoRI, NdeI
UreA-SE	CGTCGAC GAATTCCTATTA CTCCTTAATTGTTTTTACATAGTTGTC	SalI, EcoRI
UreB-BN	GAGTCCGGA TCCAT ATG AAAAAGATTAGCAGAAAAGAATATGCTTCT	BamHI, NdeI
UreB-ES	AGATCT GAATTC GTCGACTTATCACTTTATTGGCTGGTTTAGAGTTACTTCTTTGCCATC	BglII, EcoRI, SalI
VacA-BN	GAGTCCGGATTC CATATG GGCGTCCTAGATCTGTGGCAAAGCGCG	NdeI
VacA-E	CGTCGAC GAATTCTCATTA AATCCCTGTATTTTTCCATGCCTT	SalI, EcoRI
FlaB-BN	GAG TGC GAA TCC CATATG AGT TTT AGG ATA AAT ACC AAT ATC GCC	EcoRI, NdeI
FlaB-SE	CGTCGAC GAATTCTCATTA TTGTAAAAGCCTTAGACATTCTG	SalI, EcoRI
HspA-1	CCCGGG CATATG AAGTTTCAACCATTAGGAGAAAGGGTC	SmaI, NdeI
HspA-2	GGATCC GAATTCCTATTA GTGTTTTTTGTGATCATGACA	BamHI, EcoRI
HspB-1	CCCGGG CATATG GCAAAAGAAATCAAATTTTCAGATAGC	SmaI, NdeI
HspB-2	GGATCC GAATTCCTATTA CATCATGCCGCCCATGCCTCC	BamHI, EcoRI
Lpp20-1	AGATCT GAATTCATG AAAAATCAAGTTAAAAAAATTTTAGGC	BglII, EcoRI
Lpp20-2	AGATCT GTCGACTACTA CTTTTTAACCATGCCCAACTCTTCGCGCAC	BglII, SalI
HpaA-1	AGATCT GAATTCATG AAAACAAATGGTCATTTTAAGGATTTTGCA	BglII, EcoRI
HpaA-2	AGATCT GTCGACTATTA TCGGTTTCTCTTGTTTTTCAATTCCTGGGC	BglII, SalI
VA3-F	GGTCAAAATGCGGTCATGG	—
VA3-R	CCATTGGTACCTGTAGAAAC	KpnI
a The ureB, flaB, hsp and hspB genes were cloned in pET11b.The hpaA and lpp20 genes were ligated to pET21a. The vacA, tsaA, ureA, ureB, flaB and ch-a17 genes were ligated to pET3b. b Restriction endonucleases sites introduced into the primers are underlined, and initial codons and triplets complementary to stop codons are in boldface. Sequences corresponding to both ends of the genes are displayed in italics. c Restriction sites used for ligation of the PCR fragments are underlined.

DNA sequencing. Sequences were obtained by the Sanger method (Sanger et al., 1977), using the Sequenase kit (Amersham, Illinois, USA). Both strands were sequenced, and the data was compared using the MEGALIGN program of the DNASTAR software package (Madison, WI). In some cases automated DNA sequencing was carried out in a ABI 377 apparatus.

Antibodies. Anti-A17 monoclonal antibody was prepared by BiosChile IGSA from a gel-purified CH-CTX1 A17 recombinant protein using standard procedures. Human sera from infected patients were obtained from the Clinical Hospital of the Catholic University, Santiago, Chile and used for Western blot studies. H. pylori-infected patients were confirmed by ¹⁴C-urea breath test, rapid urease test and histology.

 

RESULTS

Cloning by PCR and expression in E. coli of ten genes isolated from a H. pylori Chilean strain

Based on existing information available on cloned genes from different H. pylori strains, we selected for cloning ten representative H. pylori genes from a Chilean H. pylori strain (VacA+/cagA+) CH-CTX1, obtained from a patient with duodenal ulcer. The selected genes were those that code for urease subunits (UreA and UreB, Labigne et al., 1991), flagella subunit B (flaB, Suerbaum et al., 1993), a cytoplasmic species-specific 26 kDa protein (TsaA, O'Toole et al., 1991; Alm et al., 1999), heat shock proteins (HspA and HspB, Suerbaum et al., 1994), a lipoprotein (Lpp20, Kostrzynska et al., 1994), an adhesin (HpaA, Evans et al., 1993), a central fragment of the vacuolating cytotoxin (VacA, Telford et al., 1994) and A17, a truncated internal region of the CagA protein (Covacci et al., 1993). The A17 fragment described by this group encodes a CagA-soluble region between amino acids E748 and E977 of the CagA precursor sequence of strain CCUG 17874 in which a methionine has been added to the amino terminus after subcloning in a plasmid (Covacci et al., 1993). The selection to study these genes and their products was based on indications that most of the products are immunogenic and surface-exposed antigens, with the exception of TsaA. These antigens could therefore be useful in the development of an improved diagnostic test or a vaccine. DNA sequences of the mentioned genes have been cloned from different H. pylori strains by several groups, including those from the two fully-sequenced H. pylori genomes. This information allowed us to design appropriate primers (see Table I) for PCR assays in order to amplify these genes from genomic DNA obtained from the CH-CTX1 strain and ligated into E. coli pET expression vectors. Furthermore, the A17 CagA gene fragment from strain CCUG 17874 was amplified from plasmid pEX34b.HP17/12, subcloned in pKK233-2, sequenced and used for comparison studies. The H. pylori vacA, tsaA, ureA, ureB and flaB genes were amplified and ligated into the pET3b plasmid, flaB, hpaA, ureB and lpp20 genes into pET11b and hspA and hspB into pET21a.

The size of each gene construction was verified by restriction analysis and agarose gel electrophoresis (data not shown). The lpp20 and hpaA genes were obtained as gene fusions, carrying eleven extra codons at their amino terminus, which are encoded by vector sequences corresponding to the T7 tag sequence and part of the polylinker region. Once these genes were cloned, the expression of different recombinant clones obtained in E. coli BL21(DE3) was analyzed and those clones that produced the highest levels of each particular antigen were selected for further studies (results not shown).

 

DNA sequencing and amino acid sequence comparison analysis among gene products from the Chilean and other unrelated H. pylori strains

Once cloned, 2-3 independent colonies of each gene were sequenced to verify their integrity. One clone for each gene was selected, and the nucleotide sequence was deposited in the GenBank. The selected clones in E. coli BL21(DE3) cells were TsaA-5 (GenBank Acc# AF479023), HspA-4 (Acc# AF479029), HspB-4 (Acc# 479030), HpaA-5 (AF479028), Lpp20-6 (Acc# AF479025), UreA-2 (Acc# AF479027), UreB-9 (Acc# AF479026), FlaB-10 (Acc# AF479024), VacA-1 (Acc# AF479031) and A17-16 (Acc# 479032).

The deduced amino acid sequence of each clone was compared in most cases to three counterparts; two of these were the gene products from H. pylori strains 26695 and J99, whose genomic DNAs have been fully sequenced (Tomb et al., 1997; Alm et al., 1999); the other counterpart was usually represented by the strain from which the analyzed gene was cloned early before the complete sequence of the H. pylori genomes were available. In the particular case of A17, eight amino acid sequences from different H. pylori strains, obtained from the data bank, were aligned and compared to the one from strain CH-CTX1.

In general, all deduced amino acid sequences presented a high percentage of identity, ranging from 81.0% (A17) to 100% (TsaA, Lpp20), as shown in Table II. The best conserved sequences were those of UreA, TsaA, FlaB, HspB, Lpp20, UreB, HpaA, and HspA, showing more than 97.3% identity when compared to their respective counterparts.

TABLE II

Percentage of amino acid sequence identity between gene products from a Chilean H. pylori
strain and the corresponding products from two unrelated H. pylori strains.

Gene		Percentage of amino acid sequence identity
	Strain 26995	Strain J99	Other strain
UreA	98.7	99.2	98.7 a
UreB	98.9	98.9	98.9 a
TsaA (Ag26)	100.0	98.5	98.5 b
Lpp20	99.4	100.0	98.3 c
FlaB	99.2	99.2	99.4 d
HspB	98.4	99.8	99.0 e
HspA	98.3	98.3	97.5 e
HpaA	97.7	97.3	97.7 f
VacA	93.2	94.9	94.5 g
A17	91.8	89.6	81.0 h
a Strain 85P (Labigne et al., 1991) b O'Toole's strain (O'Toole et al., 1991) c Strain 915 (Kostrzynska et al., (1994) d Strain CCUG 17874 (Suerbaum et al., 1993) e Strain CCUG 17874 (Suerbaum et al., 1994) f Strain CCUG 17874 (O'Toole et al. 1995). g Strain CCUG 17874 (Telford et al., 1994). h Strain CCUG 17874 (Covacci et al., 1993). Alignments of the amino acid sequences were carried out using the MEGALIGN program from the DNASTAR software package (LASERGENE System, Madison, WI).

The HpaA from strain CH-CTX1 presented a high identity value (97.3% - 97.7%) when compared to HpaA from strains 26695, J99 and CCUG 17874 (Table II). However, CH-CTX1 HpaA showed 94.6% identity when compared to HpaA from strain 8826 (Evans et al. (1993) which corresponds to a truncated HpaA sequence (Fig. 1). Sequence variation found in Chilean HpaA protein does not affect the conserved peptide motif KRTIQK located between amino acid positions 134-139 (Fig. 1, underlined), which is responsible for the binding to N-acetyl neuraminyl-lactose (Evans et al., 1993).

In the case of the vacA gene from strain CH-CTX1, repeated attempts to clone the entire gene using primers based on the 26695 vacA gene sequence failed. However, using internal primers (see Table I), the central region of the vacA gene (a 1.4 kb fragment) was finally cloned. Alignment of CH-CTX1 VacA partial sequence (472 amino acid residues displayed in Fig. 2) with other VacA sequences was done taking as reference positions Q₃₄₄ to I₈₁₄ of the mature protein sequence from strain 26695; Q₃₄₁ to I₈₁₂ from strain J99 and N₃₄₉ to I₈₁₉ from strain CCUG 17874. The CH-CTX1 VacA sequence comparison revealed identity in 93.2%, 94.9% and 94.5%

respectively. It was further established that the middle region of the Chilean VacA sequence corresponded to the m1 VacA allele type since a 290 bp PCR fragment was previously obtained using primers VA3-F and VA3-R (result not shown), according to defined parameters (Atherton et al., 1995). This was verified by the analysis of the deduced amino acid sequence (underlined region in Fig, 2). Moreover, strains 26695, J99 and CCUG 17874 share the m1 allele.

 

Multiple alignment of the A17 polypeptide sequences

We sequenced the A17 (clone 16) and compared the amino acid sequence with the corresponding segment of several CagA sequences. As shown in Table II and Figure 3, the Chilean A17 fragment (268 amino acids) presented a low percentage of identity when it was compared to the corresponding fragments of CagA from strains 26695, J99 and CCUG 17874. The A17 CH-CTX1 sequence was closer to that of strain 26695.

We also aligned several A17 sequences taken from the data bank, selecting A17 sequences of differing polypeptide length. We compared them with the sequence of the Chilean strain (Fig. 3) and found several repeated sequences (underlined). Figure 4A summarizes the location of the repeated elements as stippled boxes along the longest A17 sequence already described. Among these repeats, EPIYA motifs are the most interesting, as some of them have been proposed as phophorylation sites for the CagA protein (Odenbreit et al., 2000). In fact, the Tyr₉₇₂ residue in the 26695 CagA sequence (Y in the third EPIYA repeat) has been reported to be phosphorylated by a putative cellular kinase (Backert et al., 2001).

We also observed that there were at least 4 common zones (regions I, II, III and IV) where internal deletions seem to take place. In particular, deletion of region I is commonly found in Japanese isolates (J197, GC401 and J187), and deletions occurring at region IV near the C-terminus are the most extensive (Fig. 4c). The A17 size from the different strains ranged from 332 to 230 amino acids long (Fig. 4b). The longest sequences corresponded to H. pylori isolates obtained from Australian patients (ATCC43526 and NCTC11637). On the other hand, the A17 polypeptide from strain CCUG 17874 represents the shortest sequence since it lacks a long tract of 106 amino acid residues starting at amino acid position 199 in region IV (Fig. 3 and Fig 4c).

As a result of these deletions, one strain (J194) carries four EPIYA repeats, four strains (CH-CTX1, 26695, GC491 and J187) carry three EPIYA repeats, and two strains (J99 and CCUC 17874) carry only two EPIYA repeats (Fig 3, EPIYA repeats displayed in bold face). Asiatic strains carry up to 4 EPIYA motifs in contrast to the CCUG17874 strain, which carries only 2. As a result of a frame shift, the Japanese strain J194 shows a change in a short segment of the coding sequence (which is read in another frame), and one of the five EPIYA motifs is missing.

It should be noted that the A17 and VacA sequences used in our amino acid comparison studies represent only a part of the total sequences, indicating that identity values for the whole protein sequences could in fact be even lower than those described for the partial sequences.

 

Western blot analysis of ch-A17 and it-A17 antigens

To verify that the size difference between CCUG 17874 and Chilean A17 truncated CagA products actually occurs at the polypeptide level, expression studies using two cloned A17 genes were carried out. This was done by Western blot analysis on total protein extracts from recombinant clones expressing ch-A17 and it-A17 antigens, and the products were detected by using monoclonal antibody against ch-A17. As shown in Figure 5, a difference in size ( 30kDa and 28kDa respectively) was observed. In addition, immunoreactivity was significantly higher for ch-A17. Since a monoclonal antibody was used in these assays, we believe that the difference in immunoreactivity is due to a lower amount of it-A17 antigen in the cell extract.

 

DISCUSSION

Despite the fact that most of the world population is infected with H. pylori, only a fraction develops a clinical disease such as peptic ulcer or gastric cancer. The reason for this is unknown, but it has been suggested that the presence of genetic variants of H. pylori strains could be associated with particular diseases. So far, it has been shown that H. pylori seems to present one of the highest bacterial genetic variability, as shown by the use of several molecular techniques such as RAPD, RFLP, PFGE. However, when DNA sequencing analysis was employed to determine the detailed genome structure, it was found that this variability generally occurs at the third-base positions in most codons, so that these changes do not result in a highly divergent deduced amino acid sequence. Furthermore, few major changes (restricted to 9 sites in the genome) involving small deletions, inversions and translocations were detected when two sequenced genomes were compared (Alm et al., 1999). Nevertheless, two characteristic phenotypes that differ among the many known strains have been described to date: the production and activity of a vacuolating cytotoxin and the presence of the 128 kDa CagA product. Depending on the geographic location of a particular strain, the latter may or may not be associated with duodenal ulcer or gastric cancer (Crabtree et al, 1991; Graham et al., 1996; Park et al., 1998).

These correspond to strains 26695 and J99 whose genomes have recently been sequenced and a third counterpart corresponding in most cases to the strain from which the particular gene was initially obtained.

We found that most of the gene products, including UreA, UreB, TsaA, Lpp20, FlaB, HspA, HspB and HpaA present an identity value above 97.3% when compared to their counterpart strains. This high identity level suggests that phenotypes are very conserved among strains isolated from different geographic locations (strain 26695 was isolated in UK, J99 in the USA, and the others were from Australia and Japan. Moreover, these findings confirmed that DNA sequencing is the most reliable method to study variability among H. pylori strains, since most of the genetic variability previously shown actually corresponds to silent nucleotide changes at the third base of codons. These findings will be very useful if some of these putative antigens are eventually used for development of a diagnostic test or a vaccine. Contrary to what has been found with most of the protein sequences studied, the central VacA fragment and A17 (a fragment of CagA) antigens presented the lower identity values.

The HpaA sequence from strain 8826 described by Evans et al (1993) showed 94.5% identity with respect to the CH-CTX1 sequence (Fig 1), which is lower in comparison with other HpaA sequences (Table II). However, this value resulted from a shorter gene sequence, as strain 8826 encodes only 183 amino acids, as it is 78 residues shorter than the CH-CTX1 HpaA sequence. In addition, a downstream ORF matches the C-terminus of the CH-CTX1 HpaA sequence (see Fig.1). Because of this difference, this sequence data was not included in Table II. However, if the intervening non-coding tract that follows the HpaA gene in strain 8826 is read in a different frame, the resulted sequence, SELDIQEKFLKTTQSS, is almost identical to the CH-CTX1 HpaA sequence except for a single residue (shown boxed).

Figure 5. Expression of ch-A17 and it-A17 polypeptides in lysates of bacterial clones detected by Western blot assays. Cells were grown overnight with or without 1mM IPTG. Cells were lysed with Laemmli stop mix and 10 min boiling. Lysates corresponding to approximately 30 µg in 15 µl of proteins were loaded in each well. Lane = clone pETA17-16/BL21(DE3) IPTG induced, lane 2 = same as lane 1 but uninduced, lane 3 = clone pETA17-8/BL21(DE3) IPTG induced, lane 4 = same as lane 3 but uninduced, lane 5= E. coli DH5a cells with the plasmid pKK233-2 carrying the it-A17 insert induced with IPTG, lane 6 = same as lane 5 but uninduced. Std lanes contained 10 µg per lane of pre-stained protein standard markers (Broad Range, BioLabs).

In this study, we selected ten representative genes of a Chilean H. pylori strain for analysis, including those whose products are commonly associated with virulence. These genes were cloned by PCR, their DNA sequences determined, and their deduced amino acid sequences compared with their counterparts corresponding to the same genes from unrelated strains.

These correspond to strains 26695 and J99 whose genomes have recently been sequenced and a third counterpart corresponding in most cases to the strain from which the particular gene was initially obtained.

We found that most of the gene products, including UreA, UreB, TsaA, Lpp20, FlaB, HspA, HspB and HpaA present an identity value above 97.3% when compared to their counterpart strains. This high identity level suggests that phenotypes are very conserved among strains isolated from different geographic locations (strain 26695 was isolated in UK, J99 in the USA, and the others were from Australia and Japan. Moreover, these findings confirmed that DNA sequencing is the most reliable method to study variability among H. pylori strains, since most of the genetic variability previously shown actually corresponds to silent nucleotide changes at the third base of codons. These findings will be very useful if some of these putative antigens are eventually used for development of a diagnostic test or a vaccine. Contrary to what has been found with most of the protein sequences studied, the central VacA fragment and A17 (a fragment of CagA) antigens presented the lower identity values.

The HpaA sequence from strain 8826 described by Evans et al (1993) showed 94.5% identity with respect to the CH-CTX1 sequence (Fig 1), which is lower in comparison with other HpaA sequences (Table II). However, this value resulted from a shorter gene sequence, as strain 8826 encodes only 183 amino acids, as it is 78 residues shorter than the CH-CTX1 HpaA sequence. In addition, a downstream ORF matches the C-terminus of the CH-CTX1 HpaA sequence (see Fig.1). Because of this difference, this sequence data was not included in Table II. However, if the intervening non-coding tract that follows the HpaA gene in strain 8826 is read in a different frame, the resulted sequence, SELDIQEKFLKTTQSS, is almost identical to the CH-CTX1 HpaA sequence except for a single residue (shown boxed).

With respect to the central region of the Chilean VacA, sequence identity values of 93.2%, 94.9% and 94.5% were obtained when compared to those of VacA from strains 26695, J99 and CCUG17874, respectively. Also, using a PCR assay with the vacA primers VA3-F and VA3-R (see Table I), this region was found to generate an amplicon of 290 bp that corresponds to the m1 allele (displayed underlined as the corresponding amino acid sequence in Fig. 2). The m1 allele is found in most aggressive strains (Miehlke et al., 2000). This suggests that the s region of the CH-CTX1 strain should correspond to s1 allele, since the combination of alleles m1/s2 is rarely found (Atherton et al., 1995). Our recent data (not shown) indicates that s1m1 phenotype is frequently found in Chile. The prevalence of a putative s1/m1 vacA allele in the Chilean strains correlates with what it has been found in a small sample of Peruvian (Kersulyte et al., 2000). However, any possible correlation of the VacA allele found in CH-CTX1 with a common gastrointestinal disease in the Chilean population will require further studies.

The A17 antigen presented the highest variability among the genes studied in the present report. When we compared the CH-CTX1 A17 sequence with those available at the GenBank, we found not only sequence differences, but also variations in size. Comparison of the A17 sequence from the Chilean strain with the corresponding fragments from strains ATCC 43526, NCTC11637, J194, 26695, J99, GC401, J187 and CCUG 17874 showed identity values that varied between 73.5% and 95.8% identity. Chilean A17 amino acid deduced sequence presented almost the same length than that of H. pylori strain 26695 (isolated in U.K.).

Backert et al., (2001) recently reported that tyrosine 972 corresponds to the phosphorylated residue in the CagA protein sequence from strain 26695 and this residue corresponds to the tyrosine (Y) carried by the third EPIYA motif in Figure 4A. Strain J99 had an extra 19 amino acid deletion in region II in comparison with the other strains. As a result of deletions in regions II and IV, strain J99 contains only two EPIYA repeats, corresponding to the first and the third repeats displayed in Figure 4A. It was recently demonstrated that CagA from

strain J99 is not phosphorylated in vivo, in apparent agreement with the absence of one of the EPIYA repeats (Odenbreit et al., 2000). In order to explain the lack of phosphorylation reported for CagA from strain J99 the following explanation should be considered: the first EPIYA has the actual sequence EPIYT as result of the deleted region II and the other EPIYA is immersed in the ANHEPIYATIDD sequence. In both cases these sequences do not fit the general phosphorylation motif described for cellular kinases, and furthermore, in the case of the third EPIYA, it does not fit the consensus sequence that surrounds the motif.

When CH-CTX1 and CCUG 17874 A17 sequences were compared, the deletion at region IV extends 34 amino acids to the left for the A17 region from strain CCUC 17874, and this includes the third EPIYA repeat (Fig 4B). Considering that at least one tyrosine may be phosphorylated in CagA, it may be expected that the A17 region from strain CCUG 17874 should not be phosphorylated, since the segment equivalent to that containing the Tyr972 residue is absent. However, phosphorylation in other sequences can not be disregarded.

Strains ATCC43526 and NCTC11637 have 2 additional EPIYA motifs with the same adjacent sequences as Tyr972 in 26695, suggesting additional putative phosphorylation sites for these strains. It should be noted that the more EPIYA repeats there are in the CagA protein, the more tyrosine residues may be phosphorylated in the protein. However, additional phosphorylation sites have not been yet defined.

The loss of EPIYA motifs in different H. pylori strains has probably resulted from internal gene recombination events involving two of the repeated segments (see Fig. 3, EPIYA motifs in bold face) or adjacent repeats. The same explanation may apply for the 106 amino acid deletion observed in strain CCUG17874 (Fig4C), in which the repeated element that would support the internal recombination is much longer (i.e.: nucleotide sequence encoding the amino acid segment FPLKRHDKVDDLSKVG LS).

We prefer to explain the A17 size differences as partial gene deletions occurring in certain strains derived from a common ancestor strain containing a CagA gene with several repeats rather than recent insertions occurring in cagA of some particular strains. It is easier to explain these changes as deletions due to homologous recombination events taking place within these repeats.

At least for the cagA gene sequence comparison that we have shown here, most of the strains share "deleted" sequences instead of carrying "insertions" at different sites. This proposition is also supported by the general idea that multiple insertions do not often occur within similar sequences located at different repeats. However, Evans and Evans (1997) suggest that H. pylori CagA repeated sequences are probably of extrachromosomal origin. They made alignments of the nucleotide sequence of the 102 bp repeat defined by Covacci et al., (1993) with unrelated repeated sequences that shared some nucleotides at defined positions. They found striking similarities involving the repeat that encodes the EPIYA motifs and other sequences (called "iterons") from H. pylori plasmids, Shigella dysenteriae phage-encoded cytotoxin subunit A,Yersinia enterocolitica plasmid encoded lcrD gene, and the rep+ gene in Borrelia burdorferi supercoiled plasmids. These ideas are not sufficient to anticipate a relationship between the number of repeated elements and the geographic location of H. pylori strains. However, we have noticed that A17 sequences found in strains derived from Australian and Japanese patients carry the longest A17 sequences.

An important unanswered question is whether H. pylori strains having a particular CagA structure could be linked to a defined gastroduodenal disease. Covacci et al. (1993) observed that there was a significant higher antibody titer against A17 antigen from strain CCUG 17874 in sera from duodenal ulcer patients when compared to infected patients with gastritis symptoms. However, we recently found that such a correlation was not observed when we studied infected Chilean patients using the Chilean A17 antigen (Opazo et al., 1999). Yamaoka et al. (1998) have reported that H. pylori with more that 3 repeats (102 bp region) in the 3' region of the cagA gene are associated with enhanced injury and reduced survival in acidic conditions. On the contrary, Occhialini et al. (2001), studying 33 H. pylori isolates from Costa Rica have found no association between the number of repeated sequences at the 3' end of the cagA gene or the presence of tyrosine phosphorylation motifs and the clinical origin of these strains. They did not find strains with 3 repeats. Although 2 repeated sequences were found more frequently in strains from patients with gastric cancer, this difference was not significant. Further studies are required to assess whether these discrepancies are due to the variable regions of A17, or if in fact they correspond to differences in the immune response within the infected population.

Since CagA protein is normally detected on the bacterial surface and is transferred to the epithelial cell after physical contact with epithelial cells is established (Segal et al., 1999), it is expected that CagA be distributed on the bacterial envelope at same time. This finding suggests that strain-to-strain variation in the CagA sequence, particularly in the variable, highly hydrophilic and surface exposed A17 region, could be a valuable tool for the bacteria to escape the immune clearance of the host organism. A similar mechanism has been shown by other pathogens such as Streptococcus, Plasmodium falciparum, Neisseria gonorrhoeae, Borrelia hermsii (Jones et al., 1988, Connell et al., 1988). This capability could have arisen by horizontal gene transfer of the pathogenicity island where the cagA gene is located and optimized by homologous recombination events among DNA from different H. pylori strains as was shown recently (Go et al., 1996; Suerbaum et al., 1998, Kersulyte et al., 1999, Karlin et al., 1998). The recombination events may be facilitated by uptake of DNA released by other unrelated H. pylori strains during co-infection (Kersulyte et al., 1999). This hypothesis is well sustained by the natural ability of H. pylori cells to be transformed by foreign DNA (Wang et al., 1993) and by the fact that mixed infections in human patients may be quite common (Taylor et al., 1995, Hirschl et al., 1995), particularly in populations with high prevalence of infection, such as Chile (Figueroa et al., 1993). In such environments the risk of coinfection or superinfection with multiple strains is high. An alternative mechanism to explain this variability in the A17 region is by intramolecular recombination events in a single strain, which may occur more frequently in genes containing repeated sequences as CagA (Evans et al., 1998). As observed in streptococcal M protein, homologous recombination between nucleotide repeats can generate antigenic variation (Hollingshead et al., 1987).

The present work reports the cloning and sequencing of ten representative genes from a Chilean H. pylori strain concluding that most of the selected proteins (as deduced from their amino acid sequences) present a high percentage of amino acid identity when compared to their counterparts in unrelated H. pylori isolates with the exception of the A17 fragment, and to a lesser extent, the VacA central region. The A17 sequence divergence may contribute to antigenic variation and would explain the wide range of virulence among H. pylori strains.

 

ACKNOWLEDGEMENTS

This work was supported by Fondo Nacional de Ciencia y Tecnología de Chile (FONDECYT), grants # 1960342 and # 1000730.

REFERENCES

AKOPYANTS N, BUKANOV NO, WESTBLOM TU, BERG, DE (1992a) PCR-based RFLP analysis of DNA sequence diversity in the gastric pathogen Helicobacter pylori. Nucl Acids Res 20: 6221-6225

AKOPYANTS N, BUKANOV NO, WSTBLOM TU, KRESOVICH S, BERG, DE (1992b) DNA diversity among clinical isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting. Nucl Acids Res 20: 5137-5142

ALM RA, LING L - S L, MOIR DT, KING BL, BROWN ED, DOIG PC SMITH DR, NOONAN B, GUILD BC, DEJONGE BL, CARMEL G, TUMMINO PJ, CARUSO A, URIA-NICKELSEN M, MILLS DM, IVES C, GIBSON R, MERBERG D, MILLS SD, JIANG Q, TAYLOR DE, VOVIS GF, TRUST TJ (1999) Genomic-sequence comparison of two unrelated isolates of the human gastric pathogen Helicobacter pylori. Nature 397: 176-180

ATHERTON JC, CAO P, PEEK RM JR., TUMMURU MKR, BLASER MJ, COVER TL (1995) Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem 270: 17771-17777

BACKERT S, MOESE S, SELBACH M, BRINKMANN V, MEYER TF (2001) Phosphorylation of tyrosine 972 of the Helicobacter pylori CagA protein is essential for induction of a scattering phenotype in gastric epithelial cells. Mol Microbiol 42: 631- 644

BLASER MJ (1996) Role of vacA and the cagA locus of Helicobacter pylori in human disease. Aliment Pharmacol Ther 10: 71-77

CONNELL TD, BLACK WJ, KAWULA TH, BARRIT DS, DEMPSEY JA, KVERNELAND K, STEPHENSON A, SHEPART BS, MURPHY GL, CANNON JG (1988) Recombination among protein II genes of Neisseria gonorrhoeae generates new coding sequences and increases structural variability in the protein II family. Mol Microbiol 2: 227-236

COVACCI A, CENSINI S, BUGNOLI M, PETRACCA R, BURRONI D, MACCHIA G, MASSONE A, PAPINI E, XIANG Z, FIGURA N, RAPPUOLI R (1993) Molecular characterization of the 128 kDa immunodominant antigen of Helicobacter pylori associated with cytotoxicity and duodenal ulcer. Proc Natl Acad Sci USA 90: 5791-5795

COVER LT, BLASER MJ (1992) Purification and characterization of the vacuolating toxin from Helicobacter pylori. J Biol Chem 267: 10570-10575

CRABTREE JE, TAYLOR JD, WYATT JI, HEATLEY RV, SHALLCROSS TM, TOMPKINS DS, RATHBONE BJ (1991) Mucosal IgA recognition of Helicobacter pylori 120 kDa protein, peptic ulceration, and gastric pathology. Lancet 338: 332-335

DOOLEY CP, COHEN H, FITZGIBBONS PL, BAUER M, APPLEMAN MD, PEREZ-PEREZ GL, BLASER MJ (1989) Prevalence of Helicobacter pylori infection and histologic gastritis in asymptomatic persons. N Engl J Med 321: 1562-1566

DUNDON WG, MARSHALL DG, OMORAIN CA, SMYTH CJ (2000) Population characteristics of Irish Helicobater pylori isolates: a tRNA-associated locus. Ir J Med Sci 169: 137-140

EVANS DG, KARJALAINEN TK, EVANS JR, GRAHAM DY, LEE C-H (1993) Cloning, sequence, and expression of a gene encoding an adhesion subunit protein of Helicobacter pylori. J Bacteriol 175: 674-683

EVANS DG, EVANS DJ JR, LAMPERT HC, GRAHAM DY (1995) Restriction fragment length polymorphism in the adhesin gene hpaA of Helicobacter pylori. Am J Gastroenterol 90: 1282-1288

EVANS DJ, EVANS DG (1997) Direct repeat sequences in the cagA gene of Helicobacter pylori: a ghost of a chance encounter? Mol Microbiol 23: 409-411

EVANS DJ, QUEIROZ DMM, MENDES EN, EVANS DG (1998) Diversity in the variable region of Helicobacter pylori cagA gene involves more than simple repetition of a 102-nucleotide sequence. Biochem Biophys Res Commun 245: 780-784

FIGUEROA G, ACUÑA R, JASHES M, TRONCOSO M, ARELLANO L (1993) Prevalence of Immunoglobulin G antibodies to Helicobacter pylori in Chilean individuals. Eur J Clin Microbiol Infect Dis 12: 795-797

FIGURA N, GUGLIEMETTI P, ROSSOLINI A, BARBERI A, CUSI G, MUSSMANNO RA, RUSSI M, QUARANTA S (1989) Cytotoxin production by Campylobacter pylori strains isolates from patients with peptic ulcers and from patients with chronic gastritis only. J Clin Microbiol 27: 225-226

GO MF, KAPUR V, GRAHAM DY, MUSSER JM (1996) Population genetic analysis of Helicobacter pylori by multilocus enzyme electrophoresis: extensive allelic diversity and recombinational population structure. J Bacteriol 178: 3934-3938

GOODWIN CS, ARMSTRONG JA, CHILVERS T, PETERS M, COLLINS MD, SLY L, MCCONNELL W, HARPER WES (1989) Transfer of Campylobacter pylori and Campylobacter mustelae to Helicobacter gen. nov. as Helicobacter pylori comb. nov. and Helicabacter mustelae comb. nov., respectively. Int J Syst Bacteriol 39: 397-405

GRAHAM DY, KLEIN PD, EVANS DJ, ALPERT Z, OPEKUN A, BOUTTON T (1987) Campylobacter pylori detected non-invasively by the [¹³C]-urea breath test. Lancet i: 1174-1177

GRAHAM DY, KLEIN PD, OPEKUN AR, BOUTTON TW (1988) Effect of age on the frequency of active Campylobacter pylori infection diagnosed by the [¹³C]-urea breath test in normal subjects and patients with peptic ulcer disease. J Infect Dis 157: 777-780

GRAHAM DY, GENTA RM, GRAHAM DP, CRABTREE JE (1996) Serum CagA antibodies in asymptomatic subjects and patients with peptic ulcer: lack of correlation of IgG antibody in patients with peptic ulcer or asymptomatic H. pylori gastritis. J Clin Pathol 49: 829-832

HIRSCHL A, RICHTER M, MAKRISTATHIS A, PRUCKL P, WILLINGER B, SCHUTZE K, ROTTER M (1995) Single and multiple strain colonization in patients with Helicobacter pylori-associated gastritis: detection by macrorestriction DNA analysis. J Infect Dis 170: 473-475

HOLLINGSHEAD SK, FISCHETTI VA, SCOTT JR (1987) Size variation in group A streptococcal M protein is generated by homologous recombination between intragenic repeats. Mol Gen Genet 207: 196-203

JONES KF, HOLLINGSHEAD SK, SCOTT JR FISCHETTI VA (1988) Spontaneus M6 protein size mutants of group A streptococci display variation in antigenic and opsonogenic epitopes. Proc Natl Acad Sci USA 85: 8271-8275

KARLIN S, CAMPBELL AM, MRÁZEK J, (1998) Comparative DNA analysis across diverse genomes. Annu Rev Genet 32: 185-225

KERSULYTE D, CHALKAUSKAS H, BERG DE (1999) Emergence of recombinant strains of Helicobacter pylori during human infection. Mol Microbiol 31: 31-43

KERSULYTE D, MUKHOPADHYAY AK, VELAPATINO B, SU W, PAN Z, GARCIA C, HERNANDEZ V, VALDEZ Y, MISTRY RS, GILMAN RH, YUAN Y, GAO H, ALARCON T, LOPEZ-BREA M, BALAKRISH NAIR G, CHOWDHURY A, DATTA S, SHIRAI M, NAKAZAWA T, ALLY R, SEGAL I, WONG BC, LAM SK, OLFAT FO, BOREN T, ENGSTRAND L, TORRES O, SCHNEIDER R, THOMAS JE, CZINN S, BERG DE (2000) Differences in genotypes of Helicobacter pylori from different human populations. J Bacteriol 182: 3210-3218

KODAMA K, FUJIOKA T, ITO A, KUBOTA T, MURAKAMI K, NASU M (1996) Expression of vacuolating cytotoxin in clinical isolates of Helicobacter pylori. J Gastroenterol 31: 9-11

KOSTRZYNSKA M, OTOOLE PW, TAYLOR DE, TRUST TJ (1994) Molecular characterization of a conserved 20-kilodalton membrane-associated lipoprotein antigen of Helicobacter pylori. J Bacteriol 176: 5938-5948

LABIGNE A, CUSSAC V, CORCOUX P (1991) Shuttle cloning and nucleotide sequences of Helicobacter pylori genes responsible for urease activity. J Bacteriol 173: 1920-1931

LABIGNE A, REUSE H (1996) Determinants of Helicobacter pylori pathogenicity. Infect Agents Dis 5: 191-202

LAEMMLI UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685

MARSHALL B, WARREN JR (1984) Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet 1: 1311-1314

MCNULTY CAM, DENT JC (1987) Rapid identification of Campylobacter pyloridis by preformed enzymes. J Clin Microbiol 25: 1683-1686

MIEHLKE S, KIRSCH C, AGHA-AMIRI K, GUNTHER T, LEHN N, MALFERTHEINER P, STOLTE M, EHNINGER G, BAYERDORFFER E (2000) The Helicobacter pylori vacA s1, m1 genotype and cagA is associated with gastric carcinoma in Germany. Int J Cancer 87: 322-327

MITCHELL HM, HAZELL SL, LI YY, HU PJ (1996) Serological response to specific H. pylori antigens: antibody against CagA antigen is not predictive of gastric cancer in a developing country. Am J Gastroenterol 91: 1785-1788

ODENBREIT S, PÜLS J, SEDLMAIER B, GERLAND E, FISCHER W, HAAS R (2000) Translocation of Helicobacter pylori CagA into gastric epithelial cells by type IV secretion. Science 287: 1497-1500

ODENBREIT S, GEBERT B, PÜLS J, FISCHER W, HAAS R (2001) Interaction of Helicobacter pylori with professional phagocytes: role of the cag pathogenicity island and translocation, phosphorylation and processing of CagA. Cell Microbiol. 3: 21-31

OCCHIALINI A, MARAIS A, URDACI M, SIERRA R, MUÑOZ N, COVACCI A, MÉGRAUD, F (2001) Composition and gene expression of the cag pathogenicity island in Helicobacter pylori strains isolated from gastric carcinoma and gastritis patients in Costa Rica. Infect Immun 69: 1902- 1908

OPAZO P, MÜLLER I, ROLLAN A, VALENZUELA P, YUDELEVICH A, GARCIA-DE LA GUARDA R, URRA S VENEGAS A (1999) Serological response to Helicobacter pylori recombinant antigens in Chilean infected patients with duodenal ulcer, non-ulcer dyspepsia and gastric cancer. Acta Pathol Microbiol Immunol Scan 107: 1069-1078

OTOOLE P, LOGAN SM, KOSTRYNSKA M, WADSTROM T, TRUST TJ (1991) Isolation and biochemical and molecular analyses of a species-specific protein antigen from the gastric pathogen Helicobacter pylori. J Bacteriol 173: 505-513

OTOOLE W, JANZON L, DOIG P, HUANG J, KOSTRZYNSKA M, TRUST T (1995) The putative neuraminyllactose-binding hemagglutinin HpaA of Helicobacter pylori CCUG 17874 is a lipoprotein. J Bacteriol 177: 6049-6057

PARK S, PARK J, KIM J, CHO H, CHO J, LEE D, CHA Y (1998) Infection with Helicobacter pylori expressing the cagA gene is not associated with an increased risk of developing peptic ulcer diseases in Korean patients. Scan J Gastroenterol 33: 923-927

PARSONNET J, VANDERSTEEN D, GOATES J, SIBLEY RK, PRITIKIN J (1991) Helicobacter pylori infection in intestinal and diffuse-type gastric adenocarcinomas. J Natl Cancer Inst 83: 640-643

PEREZ-PEREZ GI, BLASER M (1987) Conservation and diversity of Campylobacter pyloridis major antigens. Infect Immun 55: 1256-1263

PEREZ-PEREZ GI, TAYLOR DN, BODHIDATTA L, WONGSRICHANALAI J, BAZE WB, DUNN BE, ECHEVERRIA PD, BLASER MJ (1990) Seroprevalence of Helicobacter pylori infections in Thailand. J Infect Dis 161: 1237-1241

SAIKI R (1990) Amplification of genomic DNA. p. 13-20. In INNIS MS, GELFAND DH, SNINSKY JJ, WHITE TJ (eds), PCR protocols. A guide to methods and applications. San Diego, CA: Academic Press Inc

SAMBROOK J, MANIATIS T, FRITSCH E (1989) Molecular cloning. A laboratory manual. 2^nd ed. New York: Cold Spring Harbor Laboratory

SANGER F, NICKLEN S, COULSON AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA. 74: 5463-5467

SEGAL E, CHA J, LO J, FALKOW S, TOMPKINS L (1999) Altered states: Involvement of phosphorylation of CagA in the induction of host cellular growth changes by Helicobacter pylori. Proc Natl Acad Sci USA. 96: 14559-14564

SITAS F, FORMAN D, YARNELL JWG, BURR ML, ELWOOD PC, PEDLEY S, MARKS KJ (1991) Helicobacter pylori infection rates in relation to age and social class in a population of Welsh men. Gut 32: 25-28

STUDIER W, ROSENBERG AH, DUNN JJ, DUBENDORFF JW (1990) Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 185: 60-89

SUERBAUM S, JOSENHANS C, LABIGNA A (1993) Cloning and genetic characterization of the Helicobacter pylori and Helicobacter mustelae FlaB flagellin genes and construction of H. pylori flaA- and flaB-negative mutants by electroporation-mediated allelic exchange. J Bacteriol 175: 3278-3288

SUERBAUM S, THIBERGE J-M, KANSAU I, FERRERO RL, LABIGNE A (1994) Helicobacter pylori hspA-hspB heat-shock gene cluster: nucleotide sequence, expression, putative function and immunogenicity. Mol Microbiol 14: 959-974

SUERBAUM S, SMIT JM H, BAPUMIA K, MORELLI G, SMITH NH, KUNSTMANN E, DYREK I, ACHTMAN M (1998) Free recombination within Helicobacter pylori. Proc Natl Acad Sci USA 95: 12619- 12624

TAYLOR D, HARGREAVES J, NG L, SHERBANIUK R, DEWELL J (1987) Isolation and characterization of Campylobacter pyloridis from gastric biopsies. Am J Clin Pathol 87: 49-54

TAYLOR DE, EATON M, CHANG N, SALAMA SM (1992) Construction of a Helicobacter pylori genome map and demonstration of diversity at the genome level. J Bacteriol 174: 6800-6806

TAYLOR N, FOX J, AKOPYANTS N, BERG D, THOMPSON N, SHAMES B, YAN L, FONTHAM E, JANNEY F, HUNTER F, CORREA P (1995) Long-term colonization with single and multiple strains of Helicobacter pylori assessed by DNA fingerprinting. J Clin Microbiol 33: 918-923

TEE W, LAMBERT J, SMALLWOOD R, SCHEMBRI M, ROSS BC DWYER B (1992) Ribotyping of Helicobacter pylori from clinical specimens. J Clin Microbiol 30: 1562-1567

TELFORD JL, GHIARA P, DELLORCO M, COMANDUCCI M, BURRONI D, BUGNOLI M, TECCE MF, CENSINI S, COVACCI A, XIANG Z, PAPINI E, MONTECUCCO C, PARENTE L, RAPPUOLI R (1994) Gene structure of the Helicobacter pylori cytotoxin and evidence of its key role in gastric disease. J Exp Med 179: 1653-1658

TOMB J-F, WHITE O, KERLAVAGE AR, CLAYTON RA, SUTTON GG, FLEISCHMANN RD, KETCHUM KA, KLENK HP, GILL S, DOUGHERTY BA, NELSON K, QUACKENBUSH J, ZHOU L, KIRKNESS EF, PETERSON S, LOFTUS B, RICHARDSON D, DODSON R, KHALAK HG, GLODEK A, MCKENNEY K, FITZEGERALD LM, LEE N, ADAMS MD, HICKEY EK, BERG DE, GOCAYNE JD, UTTERBACK TR, PETERSON JD, KELLEY JM, COTTON MD, WEIDMAN JM, FUJII C, BOWMAN C, WATTHEY L, WALLIN E, HAYES WS, BORODOVSKY M, KARP PD, SMITH HO, FRASER CM, VENTER JC (1997) The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388: 539-547

TOMBOLA F, MORBIATO L, DEL GIUDICE G, RAPPUOLI R, ZORATTI M, PAPINI E (2001) The Helicobacter pylori VacA toxin is a urea permease that promotes urea diffusion across epithelia. J Clin Invest 108: 929- 937

TOWBIN H, STAHALIN T, GORDON J (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Procedure and some applications. Proc Natl Acad Sci USA 81: 7897-7901

TUMMURU MKR, COVER TL, BLASER MJ (1993) Cloning and expression of a high-molecular-mass major antigen of Helicobacter pylori: evidence of linkage to cytotoxin production. Infect Immun 61: 1799-1800

VAN DOORN LJ, FIGUEREIDO C, ROSSAU R, JANNES J, VANASBROECK M, SOUSA C, CARNEIRO F, QUINT WGV (1998) Typing of Helicobacter pylori vacA gene and detection of cagA gene by PCR and reverse hybridization. J Clin Microbiol 36: 1271-1276

WANG Y, ROOS K, TAYLOR D (1993) Transformation of Helicobacter pylori by chromosomal metronidazole resistance and by a plasmid with a selectable chloramphenicol resistance marker. J Gen Microbiol 139: 2485-2493

WANG, H-J, CHANG PLC, KUO C-H, TZENG C-S, WANG W-C (1998) Characterization of the C-terminal domain of Helicobacter pylori vacuolating toxin and its relationship with extra-cellular toxin production. Biochem Biophys Res Commun 250: 397-402

YAMAOKA Y, KODAMA T, KASHIMA K, GRAHAM DY, SEPULVEDA AR (1998) Variants of the 3' region of the cagA gene in Helicobacter pylori isolates from patients with different H. pylori-associated diseases J Clin Microbiol 36: 2258-2263