SciELO - Scientific Electronic Library Online

 
vol.35 issue3-4Effects of betamethasone, sulindac and quinacrine drugs on the inflammatory neoangiogenesis response induced by polyurethane sponge implanted in mouseEffects of bicarbonate buffer on acetylcholine-, adenosine 5´triphosphate-, and cyanide-induced responses in the cat petrosal ganglion in vitro author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Biological Research

Print version ISSN 0716-9760

Biol. Res. vol.35 no.3-4 Santiago  2002

http://dx.doi.org/10.4067/S0716-97602002000300009 

Biol Res 35: 347-357, 2002

 

Heterologous Expression of Syntaxin 6 in
Saccharomyces cerevisiae

MARTIN GÖTTE1,2 and ANDREA STADTBÄUMER1

1Protogenia Research Laboratory, Protogeneia, Inc., D-48149 Münster, Germany and 2Max-Planck-
Institute of Biophysical Chemistry, D-37077, Göttingen, Germany

ABSTRACT

The molecular mechanisms of vesicular protein transport in eukaryotic cells are highly conserved. Members of the syntaxin family play a pivotal role in the membrane fusion process. We have expressed rat syntaxin 6 and its cytoplasmic domain in wild-type and pep12 mutant strains of Saccharomyces cerevisiae to elucidate the role of the syntaxin 6-dependent vesicular trafficking step in yeast. Immunofluorescence microscopy revealed a punctate, Golgi-like staining pattern for syntaxin 6, which only partially overlapped with Pep12p in wild-type yeast cells. In contrast to Pep12p, syntaxin 6 was not mislocalized to the vacuole upon expression from 2 micron vectors, which might be attributed to conserved sorting and retention signals. Syntaxin 6 was not capable of complementing the sorting and maturation defects of the vacuolar hydrolase CPY in pep12 null mutants. No dominant negative effects of either syntaxin 6 or syntaxin 6DC overexpression on CPY sorting and maturation were observed in wild-type yeast cells. We conclude that syntaxin 6 and Pep12p do not act at the same vesicular trafficking step(s) in yeast and higher eukaryotes.

Key terms: vesicular transport, SNARE, syntaxin, endosomal trafficking, vacuole protein sorting, PEP12

INTRODUCTION

A hallmark of eukaryotic cells is the presence of membrane-enclosed compartments called organelles, which contain specific subsets of lipids and proteins according to their physiological specialisation. Newly synthesized proteins have to be sorted with regard to their destination and, consequently, membrane fusion and targeting processes have to be tightly regulated (for review see Götte et al. (2000) and references therein). Many cellular proteins reach their final destination in membrane-derived transport vesicles. The basic machinery required for correct targeting and accomplishing fusion of intracellular membranes is highly conserved among eukaryotes ranging from yeast to man, and involves several protein families (Bennett and Scheller, 1993, Götte and Lazar 1999, Jahn and Südhof 1999, Götte et al. 2000). Among these, members of the syntaxin family play a pivotal role, as these type II transmembrane proteins consitute a central part of the fusion-mediating SNARE complex (Weber et al. 1998, Jahn and Südhof 1999). While their involvement in the fusion complex is not a matter of discussion, the role of syntaxins as specificity determinants of vesicle targeting is controversial (Götte and Fischer von Mollard 1998).

Several members of the syntaxin family can be found along the secretory and endocytic pathways both in yeast and higher eukaryotes. While the full complement of eight yeast syntaxins is known (Pelham 1999), the number of plant and mammalian syntaxins is considerably higher and less clear defined (see Jahn and Südhof 1999), which does most likely reflect tissue- and organ-specific functions. Four syntaxins are involved in vesicular trafficking to the yeast vacuole, covering several distinct transport routes (Götte and Lazar 1999): Pep12p is required for all known trafficking pathways into the yeast prevacuolar compartment (Gerrard et al. 2001), while Vam3p takes part in fusion events with the vacuolar membrane (Darsow et al. 1997). While deletions in the PEP12 and VAM3 genes can at least partially be compensated by high expression of the respective other syntaxin (Götte and Gallwitz 1997, Darsow et al. 1997), a deletion of both genes leads to a phenocopy of the class C vps mutants (Peterson and Emr 2001), which lack a visible vacuole and display severe vacuolar enyme sorting and maturation defects. The role of the Tlg1p and Tlg2p syntaxins is less clear defined, since they have been implicated in intra-Golgi (Tlg1p) (Coe et al. 1999), early endosome- to trans Golgi network (TGN) (Tlg1p and Tlg2p) (Lewis et al. 2000), endocytosis (Tlg2p) (Seron et al. 1998), and cytosol-to-vacuole transport (Tlg2p) (Abeliovich et al. 1999), respectively.

Heterologous expression of the highly conserved syntaxin proteins has been a useful tool in studying vesicular trafficking athways: The plant homologs of the yeast syntaxins Pep12p and Vam3p have been cloned by functional complementation of the respective yeast mutants (Bassham et al. 1995, Sato et al. 1997). Like its yeast counterpart, atVam3p localizes to the vacuole of Arabidopsis thaliana while AtPep12p seems to localize to a late post-Golgi compartment of Arabidopsis (da Silva Conceicao et al. 1997). Nakamura et al. (2000) have demonstrated that heterologous expression of murine syntaxin 7 results in complementation of the yeast vam3 and pep12 mutations. Syntaxin 7 localizes to late, but not early endosomes in NIH3T3 and NRK cells. Heterologous expression of Pep12p in CHO cells leads to a localization of Pep12p at the TGN and endosomes (Tellam et al. 1997), and both Pep12p and syntaxin 6 are capable of binding mVps45p, the mammalian homolog of the Munc/Sec-protein Vps45p in vitro (Bock et al. 1997, Tellam et al. 1997). Syntaxin 6, the most distant member of the syntaxin family, localizes to the TGN of several mammalian cell lines (Bock et al. 1997).

Using the powerful tool of heterologous expression, we expressed rat syntaxin 6 (Bock et al. 1996) and a syntaxin 6 mutant lacking the transmembrane domain in wild-type and pep12 mutant strains of Saccharomyces cerevisiae to investigate if syntaxin 6 functions at a vesicular transport step along the Pep12p pathway. Immunofluorescence microscopy was employed to study the localization of syntaxin 6 and its colocalization with a Golgi marker and Pep12p in yeast. Furthermore, the influence of syntaxin 6 and syntaxin 6DC expression on the sorting and maturation of the vacuolar hydrolase carboxypeptidase Y (CPY) was studied in wild-type and pep12 mutant strains of Saccharomyces cerevisiae. Our results indicate that the function of syntaxin 6 may not be analogous to the role of Pep12p in Saccharomyces cerevisiae.

METHODS

Materials:

Except stated otherwise, all reagents were from Sigma, Deisenhofen, Germany.

Strains, growth of cells and construction
of plasmids:

The following yeast strains were used in this study: SEY6210: Mat a suc2-D9 ura3-52 leu2-3,113 his3-D200 trp1-D901 lys2-801 (Robinson et al., 1988), YMG5: SEY6210 pep12::kanMX4 (Götte and Gallwitz, 1997a). Manipulations of E. coli and DNA were performed according to standard procedures (Sambrook et al., 1989). Yeast strains were grown in 1% yeast extract (Gibco, Eggenstein, Germany), 2% peptone 140 (Gibco, Eggenstein), 2% glucose (YEPD), or in synthetic glucose medium (SD) supplemented as necessary (Rose et al., 1990). Solid media were prepared by adding 2% agar (Gibco, Eggenstein). Temperature sensitivity of pep12-mutants was assayed as described previously (Götte and Gallwitz, 1997). Lithium acetate transformation of yeast cells was performed as previously described (Ito et al., 1983). A plasmid for expression of a hexahistidin-tagged Pep12p-fragment in E.coli was constructed by PCR-amplifying a fragment encoding amino acids 14-189 of PEP12 with the oligonucleotides GGTTTGGAACGGATCCAGATTCAGTGATTC
and
CGTTATTTATCGGATCCCTCTCAATGAC and subcloning the fragment into the BamHI site of pQE30 (Quiagen, Hilden, Germany) to yield the plasmid pMG11. The correct orientation and sequence of the insert was verified by DNA-sequencing. A yeast 2-µm plasmid (pMG67) for the expression of rat syntaxin 6 was constructed by inserting the open reading frame of syntaxin 6 into the TPI-promotor containing vector pYX242 (R&D systems, Wiesbaden, Germany) the following way. pCMV1-1 (Bock et al., 1997), harboring the syntaxin 6 open reading frame (ORF), was linearized with ClaI, blunt ended with Klenow enzyme (EC 2.7.7.7) and subsequently cut with HindIII. pYX242 was cut with EcoRI, blunt ended and subsequently cut with HindIII prior to ligation with the syntaxin 6 fragment. To clone a yeast expression plasmid for the cytoplasmic domain of syntaxin 6 (pMG68), the vector pCMV3 (Bock et al., 1997) was linearized with BglII, blunt ended and the insert excised by HindIII. The insert encoding amino acids 1-235 of syntaxin 6 was ligated to pYX242 treated as described above.

Production of Antiserum to Pep12p

Rabbits were immunized with a hexahistidin-tagged Pep12 protein fragment made from the expression plasmid pMG11. The protein was expressed in E.coli strain M15 (Quiagen, Hilden, Germany) and purified on Nickel-NTA Sepharose as described previously (Grabowski and Gallwitz, 1997). The recombinant protein was mixed with 50 % v/v HuntersTiterMax adjuvans (Sigma, Deisenhofen, Germany) and injected at a final concentration of 1 mg/ml. After an initial immunization with 1 mg protein, the rabbits were boosted every 4 weeks with 1 mg of recombinant Pep12p-fragment. An affinity column was produced by binding the Pep12p fragment expressed from pMG11 to CNBr-activated Sepharose 4b (Pharmacia, Freiburg, Germany) according to the manufacturers recommendations. The crude serum was purified by running it through this affinity column, washing with 50 mM Tris/HCl pH7.5, 150 mM NaCl and eluting the antibody with 0.2 M Glycin/HCl pH2.5. The eluate was immediately neutralized with 1 M Tris/HCl pH8.5.

Radiolabelling and immunoprecipitation

Pulse-chase experiments were performed exactly as described previously by Tsukada and Gallwitz (1996) using the anti CPY-antiserum described by Benli et al. (1996).

SDS-PAGE and Western blotting

SDS-PAGE (Laemmli, 1970) and Western blotting (Burnette, 1981) were performed as described previously. For steady-state western blotting, yeast extracts were prepared by alkaline lysis followed by TCA precipitation as described (Benli et al., 1996). Secondary horseradish-peroxidase labelled anti-mouse or anti-rabbit IgG antibodies were from Amersham Buchler, Braunschweig, Germany. The ECL-system (Amersham Buchler, Braunschweig) was used for signal detection after western blotting.

Fluorescence microscopy

Yeast cells were prepared for immunofluorescence microscopy exactly as described previously (Schröder et al., 1995). The monoclonal anti-synaxin 6 antibody 3D10 has been described previously (Bock et al., 1997) and was used in a dilution of 1:1000. The affinity-purified anti Pep12p-antibody was used at a dilution of 1:20. Flourophore-labelled secondary antibodies were from Dianova (Hamburg, Germany).

RESULTS

The mammalian syntaxin 6 localizes to the trans-Golgi network (TGN) of FAO, NRK and PC12 cell lines (Bock et al. 1997). Heterologous expression of Pep12p in CHO cells leads to a similar localization of Pep12p at the TGN and endosomes (Tellam et al. 1997). Both recombinant Pep12p and syntaxin 6 are capable of binding mVps45p, the mammalian homolog of the Sec1-family member Vps45p in vitro (Bock et al. 1997, Tellam et al. 1997). In order to determine if the function of syntaxin 6 in mammalian cells is analogous to the role of Pep12p in S. cerevisiae, we expressed syntaxin 6 in yeast cells and investigated the effects on transport of the lysosomal / vacuolar enzyme carboxypeptidase Y (CPY) to the vacuole of wild-type and pep12 mutant cells. Moreover, we studied the localization of both proteins in double-labeling immunofluorescence experiments in Saccharomyces cerevisiae.

Expression of full-length and soluble
syntaxin 6 in S. cerevisiae.

cDNAs encoding full-length syntaxin 6 (amino acids 1-255) and the cytoplasmic domain of syntaxin 6 (amino acids 2-235) were cloned into the yeast expression vector pYX242 (2µ, LEU, TPI promotor) as described in, methods'. The wild-type yeast strain SEY6210 was transformed with the constructs and a control vector bearing no insert and selected on SD-LEU agar plates. Transformands were used to prepare cell extracts which were subjected to SDS-PAGE and western blotting using a monoclonal antibody to syntaxin 6 (Bock et al. 1997) to confirm expression of the proteins in S. cerevisiae (Fig. 1). As expected, the truncated form of syntaxin 6 migrated at a lower Mr compared to the full-length protein, while no signal could be detected in mock-transformed cells. To determine the intracellular location of syntaxin 6, we employed indirect immunofluorescence using the same monoclonal antibody. As expected, the soluble domain of syntaxin 6 localizes to the cytoplasm of wild-type yeast cells (Fig. 2a) and is clearly distinct from the vector control (Fig. 2c). Expression of full-length syntaxin 6 results in a punctate staining pattern reminiscent of a Golgi-localization. (Fig. 2e). The syntaxin-positive structures are not localized near the nucleus (Fig. 2g), making an ER-localization unlikely. Moreover, almost no colocalization with the medial-Golgi marker protein Emp47p (Schröder et al. 1995) could be determined (Fig. 2f). Therefore, like in mammalian cells, heterologously expressed syntaxin 6 could localize to a late Golgi compartment in yeast.

Figure 1: Heterologous expression of rat syntaxin 6 and syntaxin 6DC in Saccharomyces cerevisiae.
The wildtype yeast strain SEY6120 was transformed with the plasmids pYX242 (vector), pYX242syntaxin 6 or pYX242syntaxin 6DC, respectively, and transformands were selected on SD-Leu agar plates. The proteins of whole cell extracts of single colonies were separated by SDS-PAGE followed by blotting to nitrocellulose. The blot membrane was probed with anti-syntaxin 6 antibody (Bock et al., 1997) at a dilution of 1:1000 and specific bands detected by ECL reaction after incubation with the POD-linked secondary antibody (1:10000 dilution) and washing with Tris buffered saline. Numbers indicate the Mr in kDa.

Figure 2: Immunolocalization of syntaxin 6 and syntaxin 6DC in Saccharomyces cerevisiae.
SEY6210 cells were transformed with syntaxin 6 constructs and prepared for immunofluorescence microscopy as described in the methods section.
a) SEY6210 pYXsyntaxin 6DC, 1st Ab: anti syntaxin 6, 1:1000; 2nd Ab:goat anti mouse IgG FITC conjugate, 1:100
b) Nomarski differential interference contrast (DIC)-picture of a)
c) SEY6210-pYX242 (control vector), antibodies as in a)
d) Nomarski DIC-picture of c)
e) SEY6210-pYX242 syntaxin 6, antibodies as in a)
f) cells like in e), 1st Ab anti Emp47p, 1:300, 2nd Ab goat anti rabbit IgG, Cy3 conjugate 1:400
g) DAPI DNA staining of cell shown in e)
h) Nomarski DIC-picture of e)

High expression of Pep12p leads to
vacuolar mislocalization.

A previous study on the localization of Pep12p in yeast cells has utilized a Pep12-GFP fusion protein construct (Rayner and Pelham 1997). In this study, Pep12 was expressed from a 2µ vector under the control of the TPI promotor. A colocalization of GFP-Pep12p and the 69 kDa subunit of the vacuolar ATPase was determined. To determine the localisation of Pep12p expressed from its endogenous promotor in wildtype yeast cells, we utilized an affinity-purified polyclonal antiserum to recombinant Pep12p (see, methods' section). In parallel, we studied the localization of Pep12p in yeast cells transformed with a 2µ plasmid for expression of Pep12p (pRS325-PEP12). The polyclonal anti-Pep12-antiserum did not detect Pep12p in the pep12 deletion strain YMG5 (Götte and Gallwitz, 1997a) in immunofluorescence experiments (Fig. 3a). In contrast, Pep12p localized in a punctate staining pattern (Fig. 3c), which is similar to the localization of the Rab GTPase Ypt51p (Singer-Krüger et al. 1995) in the isogenic wildtype strain SEY6210. High expression of Pep12p from the 2 µ plasmid resulted in a clear mislocalization to the vacuole (Fig. 3f), which is regarded the final destination of mislocalized membrane proteins in yeast (Raymond et al. 1992). This observation is helpful in explaining previous findings (Götte and Gallwitz 1997a, Götte and Gallwitz 1997b, Darsow et al. 1997) which demonstrated that Pep12p and Vam3p have overlapping functions: High expression of the endosomal syntaxin Pep12p leads to a mislocalisation to the vacuole, the steady-state location of the syntaxin Vam3p, leading to a complementation of vam3 deletion mutants.

Double-immunoflourescence labelling of
syntaxin 6 and Pep12p.

After the localization of Pep12p and syntaxin 6 were determined, double-labeling immunofluorescence experiments were performed to see if both proteins colocalize upon expression of syntaxin 6 in yeast cells. Both proteins show a punctate staining pattern, however, the patterns do not appear to overlap in a significant way (Fig. 3h-j). The number of Pep12p-positive sructures exceeds the number of syntaxin 6 positive structures, which might reflect a late Golgi localization of syntaxin 6 and an endosomal localization of Pep12p.

Figure 3: Immunolocalization of Pep12p and syntaxin 6 expressed in Saccharomyces cerevisiae.
SEY6210 (wild-type) and YMG5 (pep12 mutant, Götte and Gallwitz 1997) were transformed with the plasmids indicated and prepared for immunofluorescence microscopy as described in the, methods' section.
a) YMG5-pYX242 (control vector) 1st Ab anti-Pep12p, 1:20, 2nd Ab goat anti rabbit IgG Cy3 conjugate 1:400
b) Nomarski DIC picture of a)
c) SEY6210-pYX242, antibodies as in a)
d) DAPI DNA-staining of c)
e) Nomarski DIC picture of c)
f) SEY6210-pRS325-PEP12, antibodies as in a)
g) Nomarski DIC picture of f)
h) SEY6210-pYX242-Syntaxin 6, antibodies as in a)
i) cells as in h), 1st Ab anti-Syntaxin 6, 1:1000, 2nd antibody goat anti mouse IgG FITC conjugate 1:100
j) Nomarski DIC picture of h)

Maturation- and sorting of
carboxypeptidase Y in pep12 deletion
strains expressing syntaxin 6.

One of the most prominent defects of pep12 deletion mutants is the mislocalization and maturation defects of the vacuolar hydrolase CPY (Becherer et al. 1996).

We employed pulse-chase radiolabeling experiments to study the potential influence of syntaxin 6 expression on the maturation kinetics and the vacuolar sorting of this enzyme in the pep12 deletion strain YMG5 (Götte and Gallwitz 1997a). The ER-form of the soluble vacuolar hydrolase CPY has an Mr of 67 kDa. Upon glycosylation in the Golgi-apparatus, its Mr increases to 69 kDa. In the vacuole, this form is proteolytically processed to the mature enzyme of 62 kDa (reviewed in van den Hazel, 1996). As expected, the mature, vacuolar form of CPY can not be detected in the pep12 mutant vector control after a 30 min. chase period. The precursor form is secreted by the pep12 mutant. In contrast, the pep12 deletion strain transformed with a PEP12-containing centromeric plasmid is capable of maturating CPY and shows no secretion of CPY (Fig. 4a). Expression of syntaxin 6 does not result in a complementation of the pep12 mutation with respect to the CPY phenotype, since the enzyme is secreted and does not appear in its mature form in syntaxin 6-transformed YMG5 cells.

Figure 4: Maturation and sorting of carboxypeptidase Y in yeast cells expressing syntaxin 6 and syntaxin 6DC.
YMG5 (pep12 null) and SEY6210 (wildtype) yeast cells were transformed with the plasmids indicated and single transformands were grown to logarithmic phase. After preparation of spheroblasts cells were labelled for 15 minutes with Tran[35S]-label. Carboxypeptidase Y (CPY) was immunoprecipitated with a polyclonal antiserum (Benli et al. 1996) after 0 or 30 minutes, respectively, from the incubation solution (extracellular, `e') or from the spheroblast lysate (intracellular, `i'). The immunoprecipitates were separated by SDS PAGE after
purification of protein A Sepharose and CPY was detected by autoradiography. The arrow indicates a non-specific crossreactivity of the antiserum below 62 kDa.
a) CPY-sorting and maturation in pep12 mutant cells
b) CPY sorting and maturation in wild-type cells
pCPY= ER-modified form of CPY, p2CPY = Golgi-modified form of CPY, mCPY mature, vacuolar form of CPY

Heterologous expression of the cytoplasmic
domain of Syntaxin 6 has no dominant
negative effect on transport of the vacuolar
enzyme CPY in wild-type yeast cells.

We conducted further pulse-chase experiments to study a potential dominant negative effect of the expression of the soluble domain of syntaxin 6 on sorting and maturation of CPY. It is conceivable that proteins that interact with Pep12p in wildtype cells could also interact with syntaxin 6 if both proteins show a sufficient degree of evolutionary and functional conservation (cf Tellam et al. 1997). An expression of the cytoplasmic domain of syntaxin 6 (Syn6DC) could therefore neutralize components of the vesicular transport machinery of the Golgi-vacuole pathway by competitive binding, resulting in a dominant negative effect. As can be seen in Fig. 4b, the expression of both syntaxin 6 and syntaxin 6DC had no negative effect on the sorting on maturation of CPY. Moreover, no negative effects on cell morphology or growth rate of the transfected wild-type cells were observed (results not shown). Therefore, heterologous expression of syntaxin 6 appears not to influence the Pep12p-dependent transport step to the yeast vacuole.

DISCUSSION

In this study, we employed heterologous expression of rat syntaxin 6 in wild-type and pep12 mutant yeast cells to investigate if syntaxin 6 might have a role analogous to or overlapping with Pep12p in yeast. At first, we studied the localization of syntaxin 6 and syntaxin 6DC by immunofluorescence microscopy. Like an analogous Pep12p construct (Gerrard et al. 2000), the soluble domain of syntaxin 6 localized to the cytoplasm of wild-type yeast cells. Expression of full-length syntaxin 6 resulted in a punctate, Golgi-like staining pattern which, however, did not overlap with the medial Golgi marker Emp47p and differed from the subcellular location of Pep12p. Although syntaxin 6 was expressed from a 2µ vector, no mislocalization to the vacuole could be observed, which might be due to conserved retention mechanisms (Watson and Pessin 2000). Early cell fractionation studies have shown that Pep12p colocalizes to a small extent with the late Golgi marker protein Kex2p, but cofractionates to a much larger extent with endosomal fractions (Becherer et al. 1996). Da Silva Conceicao et al. (1997) used immunoelectron microscopy to localize the plant homologue of Pep12p, AtPEP12. While they could exclude the vacuole and the Golgi apparatus as the location of AtPEP12, the nature of the AtPEP12 positive structures remains unclear. In contrast to syntaxin 6, high expression of Pep12p from 2µ vectors resulted in a vacuolar mislocalization, which might explain its capability to suppress the vam3 mutation upon high expression (Götte and Gallwitz, 1997, Darsow et al. 1997).

In accordance with our immunolocalization studies, syntaxin 6 was not capable of suppressing the vacuolar protein sorting defects of a pep12 deletion strain. In contrast, Nakamura et al. (2000) were able to suppress both the pep12 and vam3 mutations upon expression of syntaxin 7. Work in several laboratories had previously demonstrated a certain degree of promiscuity in Vam3p and Pep12p protein function (Darsow et al. 1997, Götte and Gallwitz 1997). Nakamura et al. (2000) could also demonstrate that expression of a syntaxin 7 mutant lacking its transmembrane domain resulted in altered morphology and distribution of endodomes and a block in endocytic transport to late endosomes. Overexpression of an analogous truncated Vam3 protein results in a block of vacuolar protein sorting (Piper et al. 1997). In contrast, expression of a soluble syntaxin 6 mutant lacking the transmembrane domain had no dominant negative effect on sorting and maturation of the vacuolar hydrolase CPY in wild-type yeast cells. Surprisingly, truncated Pep12p lacking the transmembrane domain behaves in a similar way, since its (over)expression does not cause significant defects in vacuolar marker protein processing and sorting (Gerrard et al. 2000). In mammalian cells, expression of the soluble cytosolic domain of syntaxin 6 results in a block of TGN38 transport to the TGN (Mallard et al. 2002). It is conceivable that a block in this Golgi-related transport step could not result in a detectable defect on CPY transport upon heterologous expression of syntaxin 6 in yeast. Mallard et al. (2002) could demonstrate that antibodies to syntaxin 6, which forms a complex with syntaxin 16 and vti1a, inhibit early endosome to TGN transport in mammalian cells. The authors speculate that the function of syntaxin 6 and syntaxin 16 might be related to the yeast syntaxins Tlg1p and Tlg2p, which would be in accordance with observations of Presianotto-Baschong and Riezman (2002) pointing at a role of Tlg1p at an early endosomal compartment which precedes the Pep12p containing compartment on the endocytic route.

Syntaxin 6 can be co-immunoprecipitated with a-SNAP, the synaptobrevin VAMP-2 and the mammalian homologue of Vps45p, mVps45 (Bock et al. 1997). Like syntaxin 6, mVps45 localizes to the Golgi apparatus. Several studies demonstrate a function for Pep12p and Vps45p at an endosomal compartment (Cowles et al. 1994, Piper et al, 1994). Heterologous expression of Pep12p in CHO cells leads to a colocalization with a TGN marker protein and mVps45 (Tellam et al. 1997). Furthermore, Vps45p displays both genetic and physical interactions with Pep12p (Burd et al. 1997). However, these results do not necessarily contradict differing roles of Pep12p and synaxin 6: Since there are only four Sec1p-family members in yeast, but eight syntaxins, Tellam et al. (1997) have suggested that Sec1-proteins might interact with different t-SNAREs on the same transport pathway. Therefore, Vps45p might interact both with Pep12p and another syntaxin which could be the functional homolog of syntaxin 6 in yeast. In summary, our data support the view that - although previous data have suggested at least a putative partial overlap of syntaxin 6 and Pep12p functions - it is more likely that a different yeast syntaxin is functionally analogous to syntaxin 6. Recent data by Mallard et al. (2002) and Prescianotto-Baschong and Riezman (2002) support this hypothesis and point at a role for the syntaxin Tlg1p at this transport step.

ACKNOWLEDGEMENTS

Funding was provided by the Max-Planck Society, SmithKlineBeecham Foundation and Protogeneia, Inc. We are indebted to Jason B. Bock and Richard Scheller, Stanford University, Dieter Gallwitz and Stephan Schröder, Max-Planck-Institute for Biophysical Chemistry, Göttingen, and Saki D. Bisbas, CEO, Protogeneia, Inc. for providing valuable reagents and helpful discussions.

REFERENCES

ABIELOVICH H, DARSOW T, EMR SD (1999) Cytoplasm to vacuole trafficking of aminopeptidase I requires a t-SNARE Sec1p complex composed of Tlg2p and Vps45p. EMBO J. 18: 6005-6016         [ Links ]

BASSHAM DC, GAL S, DA SILVA CONCEICAO A, RAIKHEL NV (1995) An Arabidopsis syntaxin homologue isolated by functional complementation of a yeast pep12 mutant. Proc Natl Acad Sci USA 92: 7262-7266         [ Links ]

BECHERER KA, RIEDER SE , EMR SD, JONES EW (1996) Novel syntaxin homologue, Pep12p, required for the sorting of lumenal hydrolases to the lysosome-like vacuole in yeast. Mol Biol Cell 7: 579-594         [ Links ]

BENLI M, DÖRING F, ROBINSON DG, YANG X, GALLWITZ D (1996) Two GTPase isoforms, Ypt31p and Ypt32p, are essential for Golgi function in yeast. EMBO J 15: 6460-6475         [ Links ]

BENNETT MK, SCHELLER RH (1993) The molecular machinery for secretion is conserved from yeast to neurons. Proc Natl Acad Sci USA 90:2559-2563         [ Links ]

BOCK JB, LIN RC, SCHELLER RH (1996) A new syntaxin family member implicated in targeting of intracellular transport vesicles. J Biol Chem 271: 17961-17965         [ Links ]

BOCK JB, KLUMPERMAN J, DAVANGER S, SCHELLER, RH (1997) Syntaxin 6 functions in trans-Golgi network vesicle trafficking. Mol Biol Cell 8: 1261-1271         [ Links ]

BURD CG, PETERSON M, COWLES CR, EMR SD (1997) A novel Sec18p/ NSF-dependent complex required for Golgi to endosome transport in yeast. Mol Biol Cell 8: 1089-1104         [ Links ]

BURNETTE WN (1981) «Western blotting»: electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal Biochem 112: 195-203         [ Links ]

COE JG, LIM AC, XU J, HONG W (1999) A role for Tlg1p in the transport of proteins within the Golgi apparatus of Saccharomyces cerevisiae. Mol Biol Cell 10: 2407-2423         [ Links ]

COWLES CR, EMR SD, HORAZDOWSKY BF (1994) Mutations in the VPS45 gene, a SEC1 homologue, result in vacuolar protein sorting defects and accumulation of membrane vesicles. J Cell Sci 107: 3449-3459         [ Links ]

DARSOW T, RIEDER SE, EMR SD (1997) A multispecificity syntaxin homologue, Vam3p, essential for autophagic and biosynthetic protein transport to the vacuole. J Cell Biol 138: 517-529.         [ Links ]

DA SILVA CONCEICAO A, MARTY-MAZARS D, BASSHAM DC, SANDERFOOT AA, MARTY F, RAIKHEL NV (1997) The syntaxin homolog AtPEP12p resides on a late post-Golgi compartment in plants. Plant Cell 9: 571-82         [ Links ]

GERRARD SR, LEVI BP, STEVENS TH (2000) Pep12p is a multifunctional yeast syntaxin that controls entry of biosynthetic, endocytic and retrograde traffic into the prevacuolar compartment. Traffic 1: 259-269         [ Links ]

GÖTTE M, FISCHER VON MOLLARD G (1998) A new beat for the SNARE drum. Trends Cell Biol 8: 215-218         [ Links ]

GÖTTE M, GALLWITZ D (1997a) High expression of the yeast syntaxin-related Vam3 protein suppresses the protein transport defects of a pep12 null mutant. FEBS L 411: 48-52         [ Links ]

GÖTTE M, GALLWITZ D (1997b) Genetic interactions of yeast syntaxin-related receptors involved in vesicular protein transport to the vacuole. Mol Biol Cell 8 (Suppl.): 423a         [ Links ]

GÖTTE M, LAZAR T (1999) The ins and outs of yeast vacuole trafficking. Protoplasma 209: 9-18         [ Links ]

GÖTTE M , LAZAR T, YOO JS, SCHEGLMANN D, GALLWITZ D (2000) The full complement of yeast Ypt/Rab-GTPases and their involvement in exo- and endocytic trafficking. Sub Biochem 34: 133-174         [ Links ]

GRABOWSKI R, GALLWITZ D (1997) High-affinity binding of the yeast cis-Golgi t-SNARE, Sed5p, to wild-type and mutant Sly1p, a modulator of transport vesicle docking. FEBS L 411: 169-172         [ Links ]

ITO H, FUKUDA Y, MURATA K, KIMURA A (1983) Transformation of intact yeast cells treated with alkali cations. J Bacteriol 153: 163-168         [ Links ]

JAHN R, SÜDHOF TC (1999) Membrane fusion and exocytosis. Annu Rev Biochem 68: 863-911         [ Links ]

LAEMMLI UK (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685         [ Links ]

LEWIS MJ, NICHOLS BJ, PRESCIANOTTO-BASCHONG C, RIEZMAN H, PELHAM HR (2000) Specific retrieval of the exocytic SNARE Snc1p from early yeast endosomes. Mol Biol Cell 11: 23-38         [ Links ]

MALLARD F, TANG BL, GALLI T, TENZA D, SAINT-POL A, YUE X, ANTONY C, HONG W, GOUD B, JOHANNES L (2002) Early/recycling endosomes-to-TGN transport involves two SNARE complexes and a Rab6 isoform. J Cell Biol. 156: 653-664         [ Links ]

NAKAMURA N, YAMAMOTO A, WADA Y, FUTAI M (2000) Syntaxin 7 mediates endocytic trafficking to late endosomes. J Biol Chem 275: 6523-6529         [ Links ]

PIPER RC, BRYANT NJ, STEVENS TH (1997) The membrane protein alkaline phosphatase is delivered to the vacuole by a route that is distinct from the VPS-dependent pathway. J Cell Biol 138: 531-545         [ Links ]

PIPER RC, WHITTERS EA, STEVENS TH (1994) Yeast Vps45p is a Sec1p-like protein required for the consumption of vacuole-targeted, post-Golgi transport vesicles. Eur J Cell Biol 65: 305-318         [ Links ]

PELHAM HR (1999) SNAREs and the secretory pathway: lessons from yeast. Exp Cell Res 247: 1-8         [ Links ]

PETERSON MR, EMR SD (2001) The class C vps complex functions at multiple stages of the vacuolar transport pathway. Traffic 2: 476-486         [ Links ]

PRESCIANOTTO-BASCHONG C, RIEZMAN H (2002) Ordering of compartments along the yeast endocytic pathway. Traffic 3: 37-49         [ Links ]

RAYMOND CK, ROBERTS CJ, MOORE KE, HOWALD-STEVENSON I, STEVENS TH (1992) Biogenesis of the vacuole in Saccharomyces cerevisiae. Int Rev Cytol 139: 59-120         [ Links ]

RAYNER JC, PELHAM HRB (1997) Transmembrane domain-dependent sorting of proteins to the ER and plasma membrane in yeast. EMBO J 16: 1832-1841         [ Links ]

ROBINSON JS, KLIONSKY DJ, BANTA LM, EMR SD (1988) Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol Cell Biol 8: 4936-4948         [ Links ]

ROSE MD, WINSTON F, HIETER P (1990) Methods in Yeast Genetics. A Laboratory Course Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.         [ Links ]

SAMBROOK J, FRITSCH EF, MANIATIS T (1989) Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor: Cold Spring Harbor Laboratory Press         [ Links ]

SATO MH, NAKAMURA N, OHSUMI Y, KOUCHI H, KONDO M, HARA-NISHIMURA I, NISHIMURA M, WADA Y (1997) The AtVAM3 encodes a syntaxin-related molecule implicated in the vacuolar assembly in Arabidopsis thaliana. J Biol Chem 272: 24530-24535         [ Links ]

SERON K, TIEAHO V, PRESCIANOTTO-BASCHONG C, AUST T, BLONDEL MO, GUILLAUD P, DEVILLIERS G, ROSSANESE OW, GLICK BS, RIEZMAN H, KERÄNEN S, HAGENAUER-TSAPIS R (1998) A yeast t-SNARE involved in endocytosis. Mol Biol Cell 9: 2873-2889         [ Links ]

SCHRÖDER S, SCHIMMÖLLER F, SINGER-KRÜGER B, RIEZMAN H (1995) The Golgi-localization of yeast Emp47p depends on its di-lysine motif but is not affected by the ret1-1 mutation in alpha-COP. J Cell Biol 131: 895-912         [ Links ]

SINGER-KRÜGER B, STENMARK H, ZERIAL M (1995) Yeast Ypt51p and mammalian Rab5: Counterparts with similar function in the early endocytic pathway. J Cell Sci 108: 3509-3521         [ Links ]

TELLAM JT, JAMES DE, STEVENS TH, PIPER RC (1997) Identification of a mammalian Golgi Sec1p-like protein, mVps45. J Biol Chem 272: 6187-6193         [ Links ]

TSUKADA M, GALLWITZ D (1996) Isolation and characterization of SYS genes from yeast, multicopy suppressors of the functional loss of the transport GTPase Ypt6p. J Cell Sci 109: 2471-2481         [ Links ]

VAN DEN HAZEL HB, KIELLAND-BRANDT MC, WINTHER TH (1996) Biosynthesis and function of yeast vacuolar proteases. Yeast 12: 1-16         [ Links ]

WATSON RT, PESSIN JE (2000) Functional cooperation of two independent targeting domains in syntaxin 6 is required for its efficient localization in the trans-Golgi network of 3T3L1 adipocytes. J Biol Chem 275: 1261-1268         [ Links ]

WEBER T, ZEMELMAN BV, MC NEW JA, WESTERMANN B, GMACHL M, PARLATI F, SÖLLNER TH, ROTHMAN JE (1998) SNAREpins: minimal machinery for membrane fusion. Cell 92:759-772         [ Links ]

Corresponding author: Martin Götte, Ph.D. Protogeneia, Inc. Mendelstr. 11, D-48149 Münster, Germany. Telephone: (+49) 251 9801235. Fax: (+49) 251 9801236. e-mail: protogenia@technologiehof-ms.de

Received: April 1, 2002. Accepted: July 12, 2002

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License