SciELO - Scientific Electronic Library Online

 
vol.44 issue3Rat dorsal prostate is necessary for vaginal adhesion of the seminal plug and sperm motility in the uterine hornstlpA gene expression is required for arginine and bicarbonate chemotaxis in Helicobacter pylori author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

Share


Biological Research

Print version ISSN 0716-9760

Biol. Res. vol.44 no.3 Santiago  2011

http://dx.doi.org/10.4067/S0716-97602011000300008 

Biol Res 44: 269-275, 2011

The subsidiary GntII system for gluconate metabolism in Escherichia coli: Alternative induction of the gntV gene

 

Keyla M Gómez, Andrea Rodríguez, Yesseima Rodriguez, Alvaro H Ramírez and Tomás Istúriz*

Laboratorio de Fisiología y Genética de Microorganismos. Departamento de Biología Celular, Centro de Biología Celular e Instituto de Biología Experimental, Facultad de Ciencias, Universidad Central de Venezuela, Apartado 47557, Caracas 1041-A, Venezuela.


ABSTRACT

Two systems are involved in the transport and phosphorylation of gluconate in Escherichia coli. GntI, the main system, consists of high and low-affinity gluconate transporters and a thermoresistant gluconokinase for its phosphorylation. The corresponding genes, gntT, gntU and gntK at 76.5 min, are induced by gluconate. GntII, the subsidiary system, includes IdnT and GntV, which duplicate activities of transport and phosphorylation of gluconate, respectively. Gene gntV at 96.8 min is divergently transcribed from the idnDOTR operon involved in L-idonate metabolism. These genetic elements are induced by the substrate or 5-keto-D-gluconate. Because gntV is also induced in cells grown in gluconate, it was of interest to investigate its expression in this condition. E. coli gntK, idnOokan mutants were constructed to study this question. These idnO kan-cassete inserted mutants, unable to convert gluconate to 5-keto-D-gluconate, permitted examining gntV expression in the absence of this inducer and demonstrating that it is not required when the cells grow in gluconate. The results suggest that E. coli gntV gene is alternatively induced by 5-keto-D-gluconate or gluconate in cells cultivated either in idonate or gluconate. In this way, the control of gntV expression would seem to be involved in the efficient utilization of these substrates.

Key terms: E. coli, gluconate, GntII, gntV.


 

INTRODUCTION

The genetics and physiology of transport and phosphorylation of gluconate (Gnt) in Escherichia coli have turned out to be highly complex (Fig. 1). Previous work has described the genes involved, as well as their regulation. There are two systems encoded by operons distinctly regulated and located in different regions of the bacterial chromosome (Bachi and Kornberg, 1975, Istúriz et al., 1979). GntI, the main system, consists of high and low affinity gluconate transporters (GntT, GntU) and a thermoresistant gluconate kinase (GntK, Fig.lA). The gntT and the gntKU genes constitute two operons located in the bioH-asd region of the chromosome at 76.4 and 77.1 min, respectively, on the E. coli map (Fig.1B). These operons, as well as that of the Entner Doudoroff pathway (EDP, edd-eda), are induced by gluconate and negatively controlled by the gntR gene product (77.1 min) in a regulatory network known as the gntR regulon (Zwaig et al., 1973, Tong, et al., 1996, Izu et al., 1997, Peekhaus and Conway, 1998).

GntII, the subsidiary system, contains another high affinity gluconate transporter (IdnT) and also a thermosensitive gluconate kinase (GntV, Fig.1A). It was revealed by the gluconate negative phenotype of BBI, an E. coli mutant carrying two lesions linked to fdp and malA markers, affecting a subsidiary gluconate transporter and the regulatory gntR gene respectively (Bachi and Kornberg, 1975). Later, it was confirmed by the selection in mineral medium with gluconate of spontaneous fermenting pseudorevertants of E. coli HfrG6AMD2, a bioH-gntTKUR-asd deleted mutant that cannot grow in gluconate. One representative pseudorevertant, mutant C177 (AgntR), expressed the dehydratase (edd, 41 min) in mineral medium with glucose and formed when grown in media with gluconate, both a high-affinity transporter for this substrate and the thermosensitive gluconokinase. The lesion responsible for this gluconate positive phenotype designated as gntm was located at 96 min on the map, 76% linked to pyrB (Istúriz et al., 1979).

Much has been learned about the GntII system over the present and past two decades. Gene gntV, located at 96.8 min (Istúriz et al., 1986, Burland et al., 1995), is monocistronic and divergently transcribed from the idnDOTR operon (Fig.1B), which encodes enzymes that metabolizes l-idonic acid (Idn) to d-gluconate (Bausch et al., 1998). Enzyme IdnD, an l-idonate 5-dehydrogenase, converts incorporated idonate to 5-keto-d-gluconate (5kg), which in turn is transformed to gluconate by IdnO, a 5-keto-d-gluconate 5-reductase. Gluconate is then phosphorylated to 6-phosphogluconate by GntV (IdnK), whose gene is coordinately induced with the idnDOTR operon. IdnT was found to function as a permease for transport of both idonate and gluconate, indicating that the GntII system contains the enzymes of a pathway for idonate catabolism where gluconate is an intermediate (Fig. 1A). IdnR was identified as a positive regulator of the idnR regulon with 5kg as the inducer (Bausch et al., 1998). A negative regulatory effect of IdnR on the gntT, gntKU and edd-eda operons (not shown in Fig.1) is indicative of a cross-regulation between the gntR and idnR regulons (Tsunedomi et al., 2003a, Ramírez et al., 2007).

The fact that gntV is also induced in wild type cells grown in gluconate led us to wonder whether this expression is also under the positive control of the 5kg-IdnR complex. Previous reports do not favor this possibility, so the present work was undertaken to resolve the question. Although cells grown in gluconate display a poor induction of the idnDOTR operon, there is strong induction of GntK and GntV expression (Istúriz et al., 1986, Bausch et al., 2004). Moreover, in gluconate-limited mineral medium continuous culture, the total gluconate kinase activity, consisting of GntV at very low dilution rates (D), is gradually repressed as the induction of GntK increases as a consequence of the progressive increase of D and corresponding increment in the concentration of limiting substrate. These findings indicated that gntV induction, contrary to that of gntK, occurs mainly at low gluconate concentrations (Coello and Istúriz, 1992).

The possibility that gntV expression occurs independently of the IdnR-5kg complex is also suggested by the complexity of the intergenic regulatory region between gntV and idnD. This region includes promoter-operator sequences for the gntV gene and the idnDOTR operon, each with a binding element for GntR or IdnR. These regulators have 42% similarity between their entire primary sequences and 70% identity between their DNA-binding motifs. In addition, there are two binding sites for cAMP-CRP complex and another for GntR or IdnR (Izu et al., 1997, Tsunedomi et al., 2003b).

Here we demonstrate that the induction of gntV in E. coli grown in gluconate occurs in the absence of 5kg and is not coordinated with that of the idnDOTR operon; furthermore, in this condition gluconate is suggested as the inducer. The study involved the construction and analysis of two E. coli gntK, idnO<>kan sets of mutants, differentiated by the presence of the mutation gnt177 in one of them. In the presence of this mutation the E. coli idnR regulon is induced by 5kg formed from gluconate by IdnO activity (Ramírez 2004, Ramirez et al., 2007). The fact that gntK, idnO<>kan mutants grow in gluconate despite being disabled from converting it to the inducer 5kg, revealed that in this case gntV expression is independent of that of the idnDOTR operon and presumably is induced by gluconate. This alternative induction displayed by gntV seems to be important for an efficient utilization of the involved substrates. The results permit a better understanding of the cross-regulation between GntI and GntII systems.

MATERIALS AND METHODS

Bacterial strains

The Escherichia coli strains used in this study are listed in Table I. The genetic markers were previously reported (Berlyn et al., 1996).

Media

E. coli strains were grown in Luria-Bertani broth (LB) or mineral medium [MM (Tanaka et al., 1967)] or on LB plates, MM plates or gluconate bromthymol blue indicator plates [GBTB (Istúriz, et al., 1986)]. MM was supplemented with carbon source as indicated at 2 g l-1, 5 |ig ml-1 of thiamine hydrochloride, and 20 |ig ml-1 of l-amino acids as required. If necessary, MM and rich media were supplemented with 500 and 40 | g ml-1 dl-a-e-diaminopimelic acid (DAPA) respectively. When required tetracycline (Tet) was used at 15 |ig ml-1, kanamycin (Kan) at 30 mg ml-1, and 5kg at 0.4%.



Growth conditions

Cells were routinely grown aerobically at 37 °C, in volumes of 10 ml for growth curves and 20 ml for enzyme assays in 125 ml flasks fitted with side arms, on a gyratory water bath (model G76, New Brunswick) at about 200 cycles min-1. In each case, the growth was monitored by reading the optical density in a Klett colorimeter with a N° 42 filter.

Preparation of crude extracts

Cells were harvested by centrifugation, resuspended in 50 mM Tris-HCl 10 mM MgCl2 (pH 7.6) and disrupted with a Braun Sonic 2000 (12T probe, 45 wattage level) by three 20s sonication pulses (3 pulses) separated by 30s cooling periods. Cell debris was, in each case, removed by centrifugation at 27000xg for 15 min.

Enzyme assays

Gluconokinase activity and its heat inactivation were assayed as previously described (Fraenkel and Horecker, 1964, Istúriz et al., 1986). Activities are reported as nmol min-1 (mg protein)-1.

Phages and generalized transductions

The preparation of P1 lysates and generalized transductions were performed as reported (Miller, 1992) using a P1 phage stock kept in the laboratory.

DNA manipulations and transformations

Conventional and standard recombinant DNA techniques were employed (Sambrook et al., 1989).

Construction of mutants

To construct the mutants required for this work, we first constructed E. coli TK412 (idnO<>kan) using recombineering [Yu, et al., 2000 (Fig. 2A)]. First, an 1150 bp kanamycine recombinant cassette with idnO internal sequences on its flanks was generated by PCR from E. coli Y1088 proA::Tn5, kan (Young and Davis, 1983) chromosomal DNA, using PCR primers PAHNO1 (5'caggtggccgtttacgaaatcagaggcttttgaagaaaggaaca ccgcatcagaagaactcgtcaagaag3') and PAHNO2 (5'gCAGCAAAAGT ccagcttgttttctaagagataaataaagaaataatacacatggacagcaagcgaa ccg3'). Second, the recombinant cassette was used to transform E. coli TAF394 [(XcI857A(cro-bioA)], a suitable lambda lysogen for promoting linear recombination. Third, E. coli TK411 [(XcI857A(cro-bioA) idnOokan] a lysogen KanR transformant, was cured from the defective prophage by transducing it to Bio+ at 42 0C with P1 phage grown in E. coli M1. Finally, we selected idnOokan transductant E. coli TK412 (idnOokan) for later work.

The idnO gene (850 bp) only or kan inserted (1250 bp) were amplified with primers PAH5: 5'cggaattccggggggctgttaaacagccac3' and PAH6: 5'cgggatcccgagataaataaaggaataata3'(Fig. 3).

To obtain isogenic gntK, idnOokan E. coli strains with or without the gntm mutation, phage P1 grown in E. coli TK412 was used to transduce E. coli C177 to KanR (Fig. 2B). E. coli TK416, a KanR transductant and E. coli C177, were in turn made gntT+, gntK, gntU+ by transducing them to Mal+, Asd+ and restoring their bioH-asd regions with phage P1 grown in E. coli TGN282 (gntK). Two transductants were selected, E. coli TK424 (gntK, idnO<>kan, gnt177) and E. coli TK425 (gntK, gnt177) and saved for use in this work.

In order to obtain a second and similar pair of E. coli mutants that lacked the gntm mutation, strain TK412 was made GntV dependent to growth in gluconate by incorporating it a gntK allele in two steps (Fig. 2A). First, it was transduced to TetR, Mal" with P1 phage grown in E. coli TUR285. Second, a selected transductant E. coli TK414, was in turn transduced

to Mal+ with phage P1 grown in E. coli TGN282 (gntK). Among the TetS transductants, two phenotypes arose on BTB gluconate plates: one formed white non-fermenting colonies after 24 h of incubation that became yellow after 48 h incubation. The other formed unchanging, yellow fermenting colonies. It is known (Istúriz et al., 1986) and demonstrated below, that such phenotypes indicate the functioning of the thermosensitive (GntV) and thermoresistant (GntK alone or mixed with GntV) gluconate kinases respectively. A transductant of each type, E. coli TK428 and E. coli TK430 respectively, was saved for subsequent studies. PCR analysis confirmed the genotypes of mutants (not shown).



Chemicals

D-gluconic acid (potassium salt), pyrimidine nucleotides, sugars, amino acids and most other chemicals were purchased from Sigma. Media were from l-Himedia Lab. Primers were from Promega and GibcoBRL.



RESULTS

Characteristics of E. coli mutants TK424 (idnOokan, gntK, gnt177) and TK425 (gntK, gnt177)

Because E. coli mutant TK425 carries the gnt177 and gntK mutations, its growth in gluconate must depend on the inducible expression of the idnR regulon (idnDOTR and gntV operons) by the 5kg-IdnR complex (Ramírez, 2004). In this case, the inducer 5kg is formed from gluconate by the IdnO activity. Consequently, the set formed by this mutant and its isogenic E. coli TK424 was suitable to confirm the efficiency of the inserted kan cassette to abort the IdnO activity.

The above mutants grew on LB plates and mineral plates supplemented with maltose or fructose but in contrast to the gntK, gntm control strain TK425, E. coli TK424 (idnOokan, gntK, gnt177) was KanR and required 5kg to grow on mineral plates with gluconate. Moreover, the colonies of E. coli TK424 were white nonfermenting on BTB-gluconate plates, but yellow fermenting after 48 h incubation if supplemented with 5kg (Table II). In agreement with these results, although both mutants displayed normal generation times in MM with fructose (57 and 59 min) and fructose plus gluconate (58 and 65 min) , E. coli TK424 required 5kg to grow in gluconate and this growth had a lag period and a doubling time (300 and 242 min, respectively) that were longer than those of E. coli C177 (240 and 180 min) and the isogenic E. coli TK425 (30 and 80 min) grown in MM supplemented with gluconate (Table III).

The gluconate kinase activity was also measured in E. coli TK424 and TK425 grown in MM with fructose, fructose plus gluconate, and this substrate, with and without 5kg. E. coli C177 grown in MM with gluconate, was used as an additional control (Table IV). Where this activity was detected, it was thermosensitive and expressed in inducible form. The level displayed by E. coli TK424 grown in gluconate supplemented with 5kg [44 nmol min-1 (mg protein)-1] was lower than those expressed in E. coli C177 and TK425 [62 and 106 nmol min-1 (mg protein)-1] grown in the same medium without 5kg respectively (Table IV).



Characteristics of E. coli mutants TK428 (idnOokan, gntK, TetS) and TK430 (idnOokan)

Since these mutants lack the mutation gnt177, the control on the gntV expression should be as in E. coli wild type, therefore, they were suitable to investigate whether this expression in cells grown in gluconate depends on 5kg as inducer and is coordinated with that of the operon idnDOTR. This is just what occurs when E. coli is grown in idonate and the inducer 5kg is formed from idonate by the IdnD activity (Bausch et al., 1998). Both mutants grew on MM plates supplemented with maltose, fructose, LB plus kanamycine but, as expected, did not grow on LB plus tetracycline (Table II). Interestingly, in agreement with their fermenting phenotypes displayed on BTB-gluconate plates (Table II), these mutants grew in MM supplemented with gluconate without requiring 5kg (Table III); however, the lag period (245 min) and doubling time (155 min) showed by E. coli TK428 were notably higher than those in E. coli TK430 (50 and 60 min respectively).

The level of specific thermosensitive (70% heat inactivated) gluconate kinase expressed in E. coli TK428 [40 nmol min-1 (mg protein)-1] did not increase with the addition of 5kg to the medium and was significantly lower than that displayed by E. coli TK430 [141 nmol min-1 (mg protein)-1] expressing mainly the thermoresistant GntK (7% heat inactivated; Table IV).

DISCUSSION

The idnR regulon, induced by 5kg in E. coli grown in idonate, includes the gntV gene encoding a thermosensitive gluconate kinase which is also induced in gluconate grown cells. As it was not known whether in this case 5kg is the inducer, the research presented here was addressed to elucidating this question. Our results indicate that gntV is expressed in the absence of 5kg when gluconate is the substrate. They were obtained through the construction and comparative analysis of two sets of isogenic E. coli gntK, idnO<>kan mutants, differing by the presence of the mutation gnt177 in one of them.

Because idonate is not commercially available, the gluconate phenotype displayed by the set of E. coli idnO kan-cassette inserted mutants carrying the gnt177 mutation, was of central importance in the present work. Since in these mutants the idn regulon (idnDOTR operon plus gntV) is induced by 5kg in cells growing in gluconate, they were not only suitable to demonstrate the efficiency of the idnO kan-cassete insertion to abort the IdnO activity, but also permitted determining that in similar mutants lacking the gnt177 mutation, gntV expression does not involve 5kg as the inducer in cells cultivated in gluconate.

In the above context, it was demonstrated that while 5kg is essential for E. coli TK424 (idnO<>kan, gntK, gnt177) to grow in gluconate, it is not required by the isogenic E. coli TK425 (idnO+) control (Table III). Contrary to E. coli TK424, E. coli TK428 (idnO<>kan, gntK) grows in gluconate without requiring 5kg despite being blocked in the synthesis of this inducer. This indicates that under this condition gntV is expressed in absence of idnDOTR operon induction (Table III).The 5kg requirement of E. coli TK424 for growth on MM with gluconate indicated that the inserted kan cassette eliminated IdnO activity so it could be assumed that it is also absent in both E. coli TK428 and E. coli TK430.





As demonstrated, E. coli TK428 gntV expression is activated by gluconate in the absence of 5kg. Since GntR interacts with gluconate to control the gntR regulon, and GntR binding sites are included in the gntV-idnD intergenic regulatory region of the idnR regulon, this same complex might be also involved in gntV induction. Interestingly, GntR was found to have a negative effect on the expression of GntII genes in gntR-disrupted strains carrying single copies of gntV-lacZ or idnD-lacZ fusions. This effect was not observed by the addition of gluconate, presumably due to the formation of a Gnt-GntR complex (Tsunedomi et al., 2003b).

The lack of idnDOTR expression in E. coli does not alter the gluconate phenotype

E. coli TK430 (GntK+, idnOokan) grows in MM gluconate with a shorter generation time (60 vs. 155 min; Table III) and has higher levels of gluconokinase [141 vs. 40 nmol min-1 (mg protein)-1; Table IV] than E. coli TK428 (GntK-, idnOokan). Notably, while the gluconate kinase expressed in this mutant is thermosensitive (70% inactivated), that expressed by E. coli TK430 is mainly thermoresistant GntK (7% inactivated; Table IV). Despite lacking the ability to form 5kg from the substrate, this characteristic of E. coli TK430 and its short lag period (25 min; Table III) in MM with gluconate are attributes of a wild type gluconate phenotype.

The idonate-gluconate crosstalk in E. coli wild type

The characteristics of the two sets of E. coli mutants used here would seem to reveal an important and novel physiologic aspect by which the gene gntV is induced by 5kg or gluconate depending upon whether idonate or gluconate is metabolized. This alternative induction of gntV might be of importance for the development of the bacteria in its natural environment where, as opposed to lab conditions, substrate concentrations are very low. In such a situation, it is not so obvious for energy-saving reasons that the utilization of either substrate requires the induction of both regulons; i.e., idnR and gntR. The alternative induction of the E. coli gntV gene reported here would seem to impede this situation by being coordinated with that of the idnDOTR operon or the gntR regulon depending on which substrate, idonate or gluconate, is metabolized. It is of interest to advance in the molecular mechanisms associated with this alternative expression of gntV.

ACKNOWLEDGEMENTS

This work was supported by FONACIT, Grant No S1-2001000704 and CDCH-Universidad Central de Venezuela, Grant No PI 03 00 6308 2006.

REFERENCES

BACHI B, KORNBERG HL (1975) Genes involved in the uptake and catabolism of gluconate by Escherichia coli. J Gen Microbiol 90: 321-335.         [ Links ]

BAUSCH C, PEEKHAUS N, UTZ C, BLAIS T, MURRAY E, LOWARY T, CONWAY T (1998) Sequence analysis of the GntII (Subsidiary) system for gluconate metabolism reveals a novel pathway for L-idonic acid catabolism in Escherichia coli. J Bacteriol 180: 3704-3710.         [ Links ]

BAUSCH C, RAMSEY M, CONWAY T (2004) Transcriptional organization and regulation of the L-idonic acid pathway (GntII System) in Escherichia coli. J Bacteriol 186: 1388-1397.         [ Links ]

BURLAND V, PLUNKET III G, SOFIA KJ, DANIELS DL, BLATTNER FR (1995) Analysis of the Escherichia coli genome VI: DNA sequence of the region from 92.8 though 100 minutes. Nucleics Acids Res 23: 2105-2119.         [ Links ]

COELLO N, ISTÚRIZ T (1992) The metabolism of gluconate in Escherichia coli. A study in continuous culture. J Basic Microbiol 32: 309-315.         [ Links ]

FRAENKEL DG, HORECKER BL (1964) Pathways of D-glucose metabolism in Salmonella typhimurium. J Biol Chem 239: 2765-2771.         [ Links ]

ISTÚRIZ T, VITELLI-FLORES J, MARDENI J (1979) El metabolismo del gluconato en Escherichia coli. Estudio de una mutante delecionada en la región bioH-asd del mapa cromosómico. Acta Cient Vlana 30: 391-395.         [ Links ]

ISTÚRIZ T, PALMERO E, VITELLI-FLORES J (1986) Mutations affecting gluconate catabolism in Escherichia coli. Genetic mapping of the locus for the thermosensitive gluconokinase. J Gen Microbiol 132: 3209-3219.         [ Links ]

IZU H, ADACHI O, YAMADA M (1997) Gene organization and transcriptional regulation of the gntRKU operon involved in gluconate uptake and catabolism of Escherichia coli. J Mol Biol 267: 778-793.         [ Links ]

MILLER JH (1992) A short course in Bacterial Genetics. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York.         [ Links ]

PEEKHAUS N, CONWAY T (1998) Positive and negative transcriptional regulation of the Escherichia coli gluconate regulon gene gntT by GntR and the AMP (cAMP)-cAMP receptor protein complex. J Bacteriol 180: 1777-1785.         [ Links ]

RAMIREZ A (2004) El metabolismo del ácido glucónico en Escherichia coli. Estudios moleculares del sistema subsidiario GntII. Tesis Doctoral. Facultad de Ciencias, Universidad Central de Venezuela, Caracas, Venezuela.         [ Links ]

RAMIREZ A, ROSALES I, PORCO A, DÍAZ JC, ISTÚRIZ T (2007) The metabolism of gluconate in Escherichia coli. Physiological evidence of a regulatory effect of IdnR on the expression of the gntR regulon operons. Acta Cient Vlana 58: 21-28.         [ Links ]

SAMBROOK J, FRITSCH E, MANIATIS T (1989) Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.         [ Links ]

TANAKA SS, LERNER A, LIN EC (1967) Replacement of a phosphoenolpyruvate-dependent phosphotransferase by a nicotinamide adenine dinucleotide-linked dehydrogenase for the utilization of mannitol. J Bacteriol 93: 642-648.         [ Links ]

TONG S, PORCO A, ISTURIZ T, CONWAY T (1996) Cloning and molecular genetic chacarterization of the Escherichia coli gntR, gntK and gntU genes of GntI, the main system for gluconate metabolism. J Bacteriol 178: 32603269.         [ Links ]

TSUNEDOMI R, IZU H, KAWAI T, MATSUSHITA K, FERENCI T, YAMADA M (2003 a) The activator of GntII genes for gluconate metabolism, GntH, exerts negative control of GntR-regulated GntI genes in Escherichia coli. J Bacteriol 185: 1783-1795.         [ Links ]

TSUNEDOMI R, IZU H, KAWAI T, YAMADA M (2003 b) Dual control by regulators, GntH and GntR, of the GntII genes for gluconate metabolism in Escherichia coli. J Mol Microbiol 6: 41-56        [ Links ]

YOUNG RA, DAVIS RW (1983) Yeast RNA polymerase II genes: Isolation with antibody probes. Science 222: 778-782.         [ Links ]

YU D, ELLIS HL, LEE E, JEMKINS UA, COPELAND NG, COURT DL (2000) An efficient recombination system for chromosome engineering in Escherichia coli. PNAS 97: 5978-5983.         [ Links ]

ZWAIG N, NAGEL DE ZWAIG R, ISTÚRIZ T, WECKSLER M (1973) Regulatory mutations affecting the gluconate system in Escherichia coli. J Bacteriol 114: 469-473        [ Links ]

* Corresponding author: Tomás Istúriz. Instituto de Biología Experimental, Facultad de Ciencias, Universidad Central de Venezuela, Apartado 47557, Caracas 1041-A, Venezuela. toisturiz@hotmail.com Fax: 58 212 7535897; Telephone. 58 212 7510766 ext. 2164

Received: August 4, 2010. In revised form: January 1, 2011. Accepted: January 11, 2011.

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License