SciELO - Scientific Electronic Library Online

 
vol.17 número5Pleiotropic effects of the sdw1 locus in barley populations representing different rounds of recombinationAnalysis of gene expression profiles in response to Sporisorium reilianum f. sp. zeae in maize (Zea mays L.) índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Electronic Journal of Biotechnology

versión On-line ISSN 0717-3458

Electron. J. Biotechnol. vol.17 no.5 Valparaíso set. 2014

http://dx.doi.org/10.1016/j.ejbt.2014.07.002 

RESEARCH ARTICLE

 

Construction of a eukaryotic expression vector for pEGFP-FST and its biological activity in duck myoblasts

 

Xinxin Li, Jiwen Wang *, Hehe Liu, Haohan Wang, Lingli Sun, Chao Yang, Liang Li, Yi Zheng

Institute of Animal Genetics and Breeding, Sichuan Agricultural University, Ya'an 625014, China


ABSTRACT

Background

Follistatin (FST), a secreted glycoprotein, is intrinsically linked to muscle hypertrophy. To explore the function of duck FST in myoblast proliferation and differentiation, the pEGFP-FST eukaryotic expression vector was constructed and identified. The biological activities of this vector were analyzed by transfecting pEGFP-FST into cultured duck myoblasts using Lipofectamine™ 2000 and subsequently determining the mRNA expression profiles of FST and myostatin (MSTN).

Results

The duck pEGFP-FST vector was successfully constructed and was confirmed to have high liposome-mediated transfection efficiency in duck myoblasts. Additionally, myoblasts transfected with pEGFP-FST had a higher biological activity. Significantly, the overexpression of FST in these cells significantly inhibited the mRNA expression of MSTN (a target gene that is negatively regulated by FST).

Conclusions

The duck pEGFP-FST vector has been constructed successfully and exhibits biological activity by promoting myoblast proliferation and differentiation in vitro.

Keywords: Follistatin; Muscle hypertrophy; Overexpression; Transfection efficiency


 

1. Introduction

Follistatin (FST), also referred to as FSH inhibiting protein (FSP) [1], is a single chain, glycosylated polypeptide that has an inhibitory effect on follicle-stimulating hormone (FSH). Previous research has demonstrated that FST is expressed in almost all tissues (e.g., kidney, trabecular meshwork and testis [2,3,4]), and that FST possesses extensive physiological functions in these tissues. FST regulates the development and regenerative processes of the kidney, and modulates the production of androgen. The FST gene is considered a candidate gene for the induction of muscle myofiber hypertrophy, and recent research has shown that FST functions in the development of muscle in mice [5]. Previous research has also indicated that FST may promote muscle fiber hypertrophy in a mouse model via activation of satellite cells, causing them to fuse into muscle fibers. For example, both an FST transgene [6], and transfected FST that were delivered by an adeno-associated virus [7], have an effect on satellite cell proliferation and muscle fiber hypertrophy in mice [8]. Additionally, the depletion of FST in mice leads to prenatal lethality associated with impaired muscle development [9]. FST is also known to be a powerful inhibitor of myostatin (MSTN), a negative regulator of muscle development [10]. MSTN knock-out mice displayed a two-fold increase in muscle mass compared with wild-type mice [6], and over-expression of FST in these animals lead to an increase in muscle mass that was four-fold greater than in normal mice [11]. These studies suggest a close relationship between FST and skeletal muscle hypertrophy in mammals. In contrast, the roles of FST in skeletal muscle remain largely uncharacterized in birds.

Peking ducks (Anas platyrhynchos domestica) constitute a considerable portion of the poultry meat market. We previously cloned the duck FST coding domain sequence (CDS), and found that the sequence in ducks was different from that in mammals [12]. We also cloned the duck FST gene into a prokaryotic expression vector and purified a duck FST recombinant fusion protein. When administered into adult duck leg muscle tissues, the recombinant FST protein was shown to possess biological activity and promote muscle growth [13]. To better understand the mechanism of FST in regulating muscle hypertrophy in birds, we sought to construct a eukaryotic expression vector for duck FST with biological activity in promoting myoblast proliferation and differentiation.

In the present study, duck FST cDNA was inserted into the eukaryotic expression vector pEGFP-N1 to generate pEGFP-FST, which was then transfected into duck myoblasts where it exhibited some biological activities. These results provide technical support for basic research on the regulation of FST in skeletal muscle hypertrophy, and therefore elucidate potential future studies of this subject.

2. Materials and methods

2.1. Animals

Peking duck eggs at 13 d of incubation were obtained randomly from the Sichuan Agricultural University Waterfowl Breeding Experimental Farm. All of the eggs were incubated under the same conditions at a temperature of 37 ± 0.5°C and a humidity of 86–87%.

2.2. Construction of duck pMD-19T-FST and pEGFP-FST

Based on the total sequence length of the duck FST CDS [12], a pair of primers was designed: forward 5' TTGATATCGGGGACTGCTGGCTCCGGCAG 3'; and reverse 5' GGCTCGAGTTACC ACTCTAGAATGGAA 3'. The following PCR amplification cycles were performed: 5 min at 95°C for an initial denaturation, 34 cycles of 30 s at 95°C, 30 s at 51°C for primer annealing, an extension time of 60 s at 72°C, and 10 min at 72°C for the final extension. The PCR products were electrophoresed in 1.5% (w/v) agarose gels and stained with ethidium bromide. Next, the PCR products were purified and recovered using an agarose gel extraction kit (Watson Biomedical Inc., Shanghai, China). The purified FST fragments were ligated to pMD-19T vector (Takara, Japan) at a 9:1 ratio for 1 h at 16°C. For amplification, 10 µL of pMD-19T-FST solution was transformed into 50 µL E. coli DH5a cells, with the specific steps as follows: incubation on ice (-6°C) for 30 min, and heat stress (42°C) for 45 s, cold stress (-6°C) for 1 min. Positive clones were isolated and shaken in a thermostatic culture cradle overnight at 37°C, and a random analysis of 20 clones was then conducted using PCR. Finally, sequencing analysis was conducted by Invitrogen Life Technologies.

Based on restriction enzyme mapping of the CDS fragments of duck FST and the multiple cloning sites present in the pEGFP-N1 vector (Clontech, CA, USA), Xho I and EcoRI were chosen as the insertion sites. A pair of primers was designed representing the two ends of the FST CDS, and an XhoI restriction enzyme site was inserted upstream of the FST CDS. The forward primer was designed as follows: 5' CTCTCGAGTTAAATCAGAGGATCCA 3' (where CTCGAG is the XhoI site). The reverse primer was designed as follows: 5' CGGAATTCTTACCACTCTAGAATGG 3' (where GAATTC is the EcoRI site). The FST CDS should be in the same reading frame as the downstream EGFP gene sequence to ensure co-expression of the fusion protein.

To improve the amplification efficiency, the CDS of the FST gene was amplified using the following PCR cycles: 4 min at 95°C for initial denaturation, 34 cycles of 45 s at 95°C, 40 s at 52°C for primer annealing, an extension time of 60 s at 72°C, and 10 min at 72°C for a final extension. The PCR product was recovered and cloned into the pMD-19T simple vector, and was then transformed into competent DH5a cells. Positive clones were isolated and shaken overnight at 37°C. Plasmids were extracted from sense colonies using the TIANprep Mini Plasmid Kit (Tiangen, Beijing, China) and digested using XhoI and EcoRI (Takara). The reaction mixture was as follows: 4 µL of the FST gene, 2.5 µL (10 ×) T4 DNA ligase buffer, 1 µL pEGFP-N1, 1 µL of T4 DNA ligase (NEB, USA) and 16.5 µL of sterilized water. A cDNA fragment of 1032 bp was recovered and directly ligated into a pEGFP-N1 eukaryotic expression vector that had been digested with XhoI and EcoRI, and then transformed into competent DH5a cells. Positive clones were isolated and shaken overnight at 37°C and confirmed via sequencing by Invitrogen Life Technologies. The identification results for pMD-19T-FST and pEGFP-FST, as well as a map of the final recombinant plasmid (pEGFP-FST), are shown in Fig. 1.

Fig. 1. Identification of duck pMD-19T-FST and pEGFP-FST. (a) Identification of the recombinant plasmid pMD-19T-FST by enzyme digestion (XhoI and EcoRI) and 1.5% agarose gel electrophoresis after a PCR reaction. M: DL5000 Marker; 1: plasmid pMD-19T-FST digested with EcoRI and XhoI. (b) Digestion of pEGFP-FST with XhoI and EcoRI. M: DL5000Marker; 1: pEGFP-N1; 2: pEGFP-FST recombinant plasmid enzyme digestion bands. (c) The map of the final cloned recombinant plasmid (pEGFP-FST).

2.3. Cell culture

Primary duck myoblast cultures were prepared according to the method described by Liu et al. [14]. Myoblasts from 13-d-old eggs were isolated based on a differential attachment and were cultured in Dulbecco's modified Eagle's medium (DMEM, Sigma-Aldrich Japan, Tokyo, Japan) supplemented with 10% FBS and antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin). The cells were maintained in 5% CO2 at 37°C. When confluent, the cells were transferred to a 6-well plate using a split ratio of 1:2.

2.4. pEGFP-FST transfection

Duck myoblasts were transfected with pEGFP-FST when the cells reached 70% confluency. The cells were divided into three groups: pEGFP-FST, pEGFP-N1 and control. Transfection was carried out using Lipofectamine™ 2000 (Beyotime, Shanghai) according to the manufacturer's instructions. In each well, cells were transfected with the following liposomal transfection mixture: 12.5 µL (2.5 µg) of DNA, 47.5 µL of DMEM and 15 µL of liposomes. After 12 and 24 h, the cells were collected to conduct subsequent assays. All experiments were performed in triplicate.

2.5. Analysis of transfection efficiency

After 24 h, the expression of EGFP in myoblasts was observed under a fluorescence microscope (Nikon TE2000, Japan), and the number of cells in every well exhibiting positive EGFP expression was counted (Fig. 2).

Fig. 2. Lipofection efficiency of myoblasts (fluorescence images taken 24 h post-transfection). (a) The expression of EGFP in duck myoblasts (× 100). Note: a, b and c show pEGFP-FST transfected myoblasts (transfection); d, e and f show pEGFP-N1-transfected myoblasts; and g, h and i show the control. Comparing by rows, a, d and g show the shape of myoblasts (Cy3); b, e and h reflect the green fluorescent protein (FITC); and c, f and i show the overlap of the two images. The cells containing EGFP were identified as positive cells. (b) This figure shows that the highest efficiency of transfection was obtained with the pEGFP-FST group and the pEGFP-N1 group. The efficiencies were 77% and 70%, respectively. The number of myoblasts containing EGFP protein was counted and analyzed using Image-Pro Plus 6.0 software (Media Cybernetics, Bethesda, MD). The arrows in (c) indicate the expression of green fluorescent EGFP.

2.6. MTT assay and morphological observation

Myoblast viability was determined based on the amount of MTT reduced to formazan. After transfection with either pEGFP-FST or pEGFP-N1, culture medium containing 0.5 mg/mL MTT was added to each well and the cells were incubated at 37°C for 3 h, at which point DMSO was added to dissolve the formazan crystals. The absorbance at 570 nm was then measured. Twenty-four hours after transfection, changes in cell morphology were observed and the number of myoblasts in the three groups was recorded (Fig. 3).

Fig. 3. Effect of pEGFP-FST transfection on myoblast morphology and vitality in vitro (× 100). (a) pEGFP-FST group, B: pEGFP-N1 group, C: Control group, D: The number of myoblasts in the pEGFP-FST group, the pEGFP-N1 group and the control group. The number of myoblasts was counted and analyzed using Image-Pro Plus 6.0 software (Media Cybernetics, Bethesda, MD). E: Vitality of duck myoblasts after transfection with pEGFP-FST for 24 h. The results are presented as the mean ± SEM (n = 3). Data were analyzed by ANOVA and Tukey's test.

2.7. Real-time PCR analysis

Total RNA was isolated from duck myoblasts using the Trizol reagent (Takara, Dalian, China), and the concentration of each RNA sample was determined using a NanoVue Plus spectrophotometer (GE Healthcare Bio-Sciences AB, Sweden). All RNA samples were subsequently adjusted to the same concentration. A SYBR Prime Script RT-PCR Kit (TaKaRa, Dalian, China) was then used for reverse transcription-PCR (RT-PCR) according to the manufacturer's protocol. The relative mRNA expression of FST and MSTN was analyzed by real-time PCR using the IQ™5 System (Bio-Rad, USA) with ß-actin (Genbank No: EF667345.1) and GAPDH (Genbank No: GU564233.1) serving as reference genes. The primer information is listed in Table 1. The PCR reactions were carried out in a 96-well plate in a 25 µL reaction volume. Each reaction mixture contained 12.5 µL of SYBR® Green I PCR Master Mix (Takara, Japan), 2.5 µL of normalized template DNA, 0.5 µL of each primer and 9.5 µL of sterile ultrapure water. The relative expression of FST and MSTN was calculated using the “normalized relative quantification” method followed by 2-??Ct. PCR reactions were performed in triplicate for each sample.

Table 1. Primers used in this study.

 
Gene Primer sequence (5'–3') Product length (bp) Annealing temperature (°C)
FST
F ACAACTTACCCAAGCGAGTGTG 145 58
R CATCTTCCTCTTCTTCCTCTGG
 
MSTN
F GCACTGGTATTTGGCAGAGTATT 142 60
R TCACCTGGTCCTGGGAAAGT
 
ß-actin
F GCTATGTCGCCCTGGATTTC 168 55
R CACAGGACTCCATACCCAAGAA
 
GAPDH
F AAGGCTGAGAATGGGAAAC 254 50
R TTCAGGGACTTGTCATACTTC
 
Note: F, R - forward and reverse primers, respectively.

2.8. Statistical analysis

The real-time PCR data were subjected to analysis of variance (ANOVA), and the means were compared for significance using Tukey's test, performed by SAS (SAS Institute, Cary, NC, USA). A p-value of less than 0.05 was considered to be statistically significant.

3. Results

3.1. Identification of duck pMD-19T-FST and pEGFP-FST

Complete digestion of the pMD-19T-FST vector with XhoI and EcoRI produced the expected fragments (Fig. 1a).

The target gene fragment was successfully ligated to the 5' end of the EGFP cDNA, guaranteeing that the CDS of FST was in the same reading frame as EGFP. The predicted 1032 bp fragment was obtained by complete digestion of the recombinant pEGFP-FST plasmid with XhoI and EcoRI (Fig. 1b).

3.2. Transfection efficiency analysis of the duck expression vector pEGFP-FST in vitro

The expression of the EGFP reporter gene was observed using fluorescence microscopy (Nikon, Japan) 24 h after transfection (Fig. 2). The results showed that, in both the pEGFP-FST group and the pEGFP-N1 group, large numbers of myoblasts expressed green fluorescent protein. EGFP was expressed in 77% of the cells in the pEGFP-FST group and 70% of the cells in the pEGFP-N1 group (Fig. 2b), suggesting that both pEGFP-FST and pEGFP-N1 can be effectively transfected into myoblasts, resulting in high levels of EGFP expression.

3.3. Effect of pEGFP-FST transfection on myoblast morphology and vitality in vitro

Myoblast cell counts were significantly increased after pEGFP-FST was successfully transfected into duck myoblasts, with the majority of cells forming myotubes by fusion as shown in Fig. 3a–c. The numbers of myoblasts in both the pEGFP-N1 and controls group were significantly lower than in the pEGFP-FST group, with only a few cells fusing into myotubes, as shown in Fig. 3d (P < 0.05). There were no obvious differences in either the number of myoblasts or myoblast morphology between the pEGFP-N1 group and the control group. These results suggested that transfection using Lipofectamine™ 2000 was not toxic to the cells, and that FST could promote the proliferation and differentiation of myoblasts. Additionally, myoblast viability increased significantly in the pEGFP-FST group, as demonstrated by the MTT assay. As shown in Fig. 3e, the pEGFP-FST group produced a higher OD value than the pEGFP-N1 group or the control group (P < 0.05). Collectively, these results indicate that pEGFP-FST increases myoblast viability and significantly promotes the proliferation and differentiation of myoblasts.

3.4. Effect of pEGFP-FST transfection on the mRNA expression of FST and MSTN

As shown in Fig. 4a, FST mRNA expression was significantly higher in the pEGFP-FST group as compared to the pEGFP-N1 or control groups (P < 0.01), suggesting that FST was successfully transfected into myoblasts and efficiently expressed. Twenty-four hours post-transfection, the expression of FST in myoblasts was higher than at 12 h, indicating that the transfection efficiency increased over time. As shown in Fig. 4b, MSTN mRNA expression in the pEGFP-FST group was significantly lower than that in the pEGFP-N1 or control groups (P < 0.05). Nevertheless, the expression of MSTN increased over time, indicating that the expression of MSTN also occurred in a time-dependent manner. Taken together, these results demonstrate that the over-expression of FST inhibits the expression of MSTN.

Fig. 4. Effect of pEGFP-FST transfection on the mRNA expression of FST and MSTN after 12 and 24 h. (a) The relative expression of FST after transfection for 12 and 24 h. (b) The relative expression of MSTN after transfection for 12 and 24 h. Duck ß-actin (EF667345) and GADPH (AY436595) were used as the internal controls. The label “**” above the bar indicates P < 0.01, and “*” above the bar indicates P < 0.05.

4. Discussion

The eukaryotic expression system is an effective way to explore the functions of new genes in vitro, and can be used in both the medical and agricultural fields. The eukaryotic expression vector pEGFP-C1-BMP-2 was originally generated and transfected into COS-7 cells to explore the function of BMP in bone and cartilage development [15]. Since the pEGFP vector carries the EGFP gene, any expressed fusion proteins from the pEGFP plasmid will contain both the target protein and the EGFP protein. Additionally, the pEGFP plasmid has been demonstrated to have no toxic effects on cells [16]. Therefore, to study the effect of duck FST on myoblasts and to lay the foundation for a thorough study of the role of FST in duck muscle development, we generated a pEGFP-FST eukaryotic expression vector.

To investigate the biological activity of pEGFP-FST in myoblasts, the pEGFP-FST eukaryotic vector was inserted into duck myoblasts via liposome-mediated transfection. The results showed that pEGFP-FST possessed specific biological activities. The transfection efficiency of pEGFP-FST was significantly higher than that of either pEGFP-N1 or the control vector, and pEGFP-FST enhanced duck myoblast viability while mildly promoting myoblast proliferation and differentiation. Twenty-four hours post-transfection, pEGFP-FST displayed high transfection efficiency (77%) that was consistent with the previous research showing a high transfection efficiency for the pIRES2-EGFP-myf6 vector in bovine myoblasts [17]. However, further study is needed to determine the underlying mechanisms by which FST affects duck myoblast proliferation and differentiation.

FST is a secreted glycoprotein that promotes muscle hypertrophy. Previous research has shown that FST is capable of inducing muscle hypertrophy by activating satellite cells and influencing the expression of myogenesis-related genes [13]. Additionally, inhibition of MSTN by FST is a recently identified novel mechanism for the promotion of muscle hypertrophy [8]. MSTN is a strong negative regulator of skeletal muscle mass. In mammals, FST can inhibit the binding of the C-terminus of the MSTN dimer to the ActRIIB receptor in transfected COS cells [6]. Using a two-hybrid analysis, it was also shown that FST and mature MSTN form a complex in both yeast and mammalian cells [10]. Additionally, systemic administration of FST in mice inhibits the wasting effect of MSTN in vivo [18]. In our research, FST mRNA expression increased significantly after transfection with pEGFP-FST, with higher expression of FST at 24 h than at 12 h. Our research is consistent with that of Sun et al. [17], who also showed that the expression of pEGFP-MyoD in myoblasts is higher at 24 h than 12 h and 36 h. To determine the role of FST in duck myoblasts, as well as to further validate the effect of FST over-expression on MSTN, we examined their expression levels of both genes in pEGFP-FST, pEGFP-N1 and control myoblasts at two stages (Fig. 4b). The results showed that the expression levels of MSTN were significantly lower in the pEGFP-FST group than in the other two groups at both stages, and that the expression of MSTN in the 24 h group was higher than that in the 12 h group. The level of MSTN expression did not change remarkably in the pEGFP-N1 or the control group, indicating that the over-expression of FST significantly inhibited the expression of MSTN. In duck myoblasts, transfected pEGFP-FST may serve as an inhibitor to down-regulate the expression of MSTN. Moreover, the results demonstrated that the mechanism by which FST inhibits MSTN in duck was similar to what has been previously reported in mammals, and also showed that duck pEGFP-FST possessed specific biological activity resulting in the inhibition of MSTN mRNA expression in myoblasts. Thus, these results further demonstrate the successful construction of pEGFP-FST.

Taken together, these results suggest that the duck pEGFP-FST plasmid has been successfully constructed, and that it demonstrates biological activity by promoting myoblast proliferation and differentiation in vitro. Our preliminary studies provide groundwork for further research on the roles of FST in duck myoblasts, and pave the way for future studies of the intracellular downstream signaling mechanisms responsible for FST's ability to promote duck muscle development.

Financial support

Agency/Institution: National Waterfowl Industrial Technology System. Program Financial support: Program for Breeding Research of Sichuan province; and Poultry Genetic Resources Exploring and Innovation Research Project. Project number: No. CARS-43-6, (2011NZ0099-8), and (No. 13TD0034).

Author contribution

Proposed the theoretical frame: JW, XL, HL; Conceived and designed the experiments: XL, JW; Contributed reagents/materials/analysis tools: HW, LS, CY; Wrote the paper: XL; Performed the experiments: XL, HW, LS; Analyzed the data: XL, LL, YZ.

 

References

1. Phillips DJ, De Kretser DM. Follistatin: A multifunctional regulatory protein. Front Neuroendocrinol 1998;19:287-322. http://dx.doi.org/10.1006/frne.1998.0169.         [ Links ]

2. Fitzgerald AM, Benz C, Clark AF, Wordinger RJ. The effects of transforming growth factor-β2 on the expression of follistatin and activin A in normal and glaucomatous human trabecular meshwork cells and tissues. Invest Ophthalmol Vis Sci 2012;53: 7358-69. http://dx.doi.org/10.1167/iovs.12-10292.         [ Links ]

3. Luo Y, Zhang C, Zhao Z, Fan JS, Zhang JH. Molecular cloning, sequence analysis and tissue expression of follistatin gene in Dazu black goat. China Agric Sci 2011;44: 4700-5. http://dx.doi.org/10.3864/j.issn.0578-1752.2011.22.018.         [ Links ]

4. Winnall WR, Wu H, Sarraj MA, Rogers PA, De Kretser DM, Girling JE, et al. Expression patterns of activin, inhibin and follistatin variants in the adultmalemouse reproductive tract suggest important roles in the epididymis and vas deferens. Reprod Fertil Dev 2012;25:570-80. http://dx.doi.org/10.1071/RD11287.         [ Links ]

5. Gangopadhyay SS. Systemic administration of Follistatin288 increases muscle mass and reduces fat accumulation in mice. Sci Rep 2013;3:2441. http://dx.doi.org/10.1038/srep02441.         [ Links ]

6. Lee SJ, McPherron AC. Regulation ofmyostatin activity andmuscle growth. Proc Natl Acad Sci U S A 2001;98:9306-11. http://dx.doi.org/10.1073/pnas.151270098.         [ Links ]

7. Haidet AM, Rizo L, Handy C, Umapathi P, Eagle A, Shilling C, et al. Long-term enhancement of skeletal muscle mass and strength by single gene administration of myostatin inhibitors. Proc Natl Acad Sci U S A 2008;105:4318-22. http://dx.doi.org/10.1073/pnas.0709144105.         [ Links ]

8. Gilson H, Schakman O, Kalista S, Lause P, Tsuchida K, Thissen JP. Follistatin induces muscle hypertrophy through satellite cell proliferation and inhibition of both myostatin and activin. Am J Physiol Endocrinol Metab 2009;297:E157-64. http://dx.doi.org/10.1152/ajpendo.00193.2009.         [ Links ]

9. Lee SJ, Lee YS, Zimmers TA, Soleimani A, Matzuk MM, Tsuchida K, et al. Regulation of muscle mass by follistatin and activins. Mol Endocrinol 2010;24:1998-2008. http://dx.doi.org/10.1210/me.2010-0127.         [ Links ]

10. Amthor H, Nicholas G, McKinnell I, Kemp CF, Sharma M, Kambadur R, et al. Follistatin complexes Myostatin and antagonises Myostatin-mediated inhibition of myogenesis. Dev Biol 2004;270:19-30. http://dx.doi.org/10.1016/j.ydbio.2004.01.046.         [ Links ]

11. Lee SJ. Quadrupling muscle mass in mice by targeting TGF-β signaling pathways. PLoS One 2007;2:e789. http://dx.doi.org/10.1371/journal.pone.0000789.         [ Links ]

12. Liu HH, Jin HB, Wang JW, Cao W, Han CC, Li L, et al. Molecular cloning and analysis of duck follistatin gene cds and its expression in Escherichia coli. Acta Vet Zootech Sin 2011;42:190-5.         [ Links ]

13. Liu HH, Wang JW, Yu HY, Zhang RP, Chen X, Jin HB, et al. Injection of duck recombinant follistatin fusion protein into duck muscle tissues stimulates satellite cell proliferation and muscle fiber hypertrophy. Appl Microbiol Biotechnol 2012;94:1255-63. http://dx.doi.org/10.1007/s00253-012-3908-4.         [ Links ]

14. Liu HH, Li L, Chen X, Cao W, Zhang RP, Yu HY, et al. Characterization of in vitro cultured myoblasts isolated from duck (Anas platyrhynchos) embryo. Cytotechnology 2011;63:399-406. http://dx.doi.org/10.1007/s10616-011-9356-7.         [ Links ]

15. Wang XY, Chen ZH, Zhang RY, Liu SQ, Mei Z, Yu YY, et al. Construction of a eukaryotic expression vector pEGFP-C1-BMP-2 and its effect on cell migration. J Zhejiang Univ Sci B 2012;B13:356-63. http://dx.doi.org/10.1631/jzus.B1100386.         [ Links ]

16. Collares T, Campos VF, De Leon PMM, Cavalcanti PV, Amaral MG, Dellagostin OA, et al. Transgene transmission in chickens by sperm-mediated gene transfer after seminal plasma removal and exogenous DNA treated with dimethylsulfoxide or N, N-dimethylacetamide. J Biosci 2011;36:613-20. http://dx.doi.org/10.1007/s12038-011-9098-x.         [ Links ]

17. Sun WQ, Li L, Wang JW, Liu HH, Wang HH, Li XX, et al. Overexpression of MyoD increased the expression of RNA-binding proteins Rbm24 and Rbm38. J Anim Vet Adv 2014;13:280-6.         [ Links ]

18. Zimmers TA, Davies MV, Koniaris LG, Haynes P, Esquela AF, Tomkinson KN, et al. Induction of cachexia in mice by systemically administered myostatin. Science 2002;296:1486-8. http://dx.doi.org/10.1126/science.1069525.         [ Links ]

 


*Corresponding author: E-mail address: wjw2886166@163.com (J.Wang).

Received 9 February 2014, Accepted 30 June 2014, Available online 5 August 2014

Appendix A. Supplementary data

Download file (576 K)

Copyright © 2014 Pontificia Universidad Católica de Valparaíso. Production and hosting by Elsevier B.V. All rights reserved. Peer review under responsibility of Pontificia Universidad Católica de Valparaíso.

 

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons