SciELO - Scientific Electronic Library Online

 
vol.18 número1A comparative proteomic study of white and black glutinous rice leavesGenetic diversity in two Italian almond collections índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Electronic Journal of Biotechnology

versión On-line ISSN 0717-3458

Electron. J. Biotechnol. vol.18 no.1 Valparaíso ene. 2015

http://dx.doi.org/10.1016/j.ejbt.2014.11.004 

RESEARCH ARTICLE

Development and significance of RAPD-SCAR markers for the identification of Litchi chinensis Sonn. by improved RAPD amplification and molecular cloning

 

Jingliang Chenga, Yan Longa, Md. Asaduzzaman Khana, Chunli Weia, Shelly Fub, Junjiang Fua, c, *

a Research Center for Preclinical Medicine, Luzhou Medical College, Luzhou, Sichuan Province 646000, China
b Michael E. DeBakey High School for Health Professions, Houston, TX 77021, USA
c Forensic Center, Luzhou Medical College, Luzhou, Sichuan Province 646000, China


ABSTRACT

Background

Analysis of genetic diversity is important for the authentication of a species. Litchi (Litchi chinensis Sonn.) is a subtropical evergreen tree. Recently, L. chinensis has been characterized by an improved random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) analysis. The goal of this study was to develop sequence-characterized amplified region (SCAR) markers from the improved RAPD fragments for the genetic analysis of L. chinensis.

Results

The improved RAPD fragments from L. chinensis were cloned, sequenced and converted into stable SCAR markers. Sequencing of three cloned RAPD fragments revealed that the clone L7-16 consisted of 222 nucleotides (GenBank accession number KM235222), clone L9-6 consisted of 648 nucleotides (GenBank accession number KM235223), and clone L11-26 consisted of 369 nucleotides (GenBank accession number KM235224). Then, specific primers for SCAR markers L7-16, L9-6, and L11-26 were designed and synthesized. PCR amplification was performed using DNA templates from 24 different samples, including 6 samples of L. chinensis and other plants. The SCAR marker L9-6 was specific for all of the L. chinensis samples, the SCAR marker L11-26 specific for five L. chinensis samples, and the SCAR marker L7-16 only specific for the samples from Luzhou.

Conclusions

This study developed stable SCAR markers for the identification of L. chinensis by the cloning of the improved RAPD fragments. Combining RAPD and SCAR markers provides a simple and reliable tool for the genetic characterization of plant species.

Keywords: Genetic authentication; Molecular cloning; Random amplified polymorphic DNA; Sequence-characterized amplified region marker


 

1. Introduction

Analysis of genetic diversity is important for the identification and authentication of a species. This is also important for the genetic profiling and conservation of organisms. For the analysis of genetic diversity, a number of molecular marker techniques have been developed over the last thirty years. These include random amplified polymorphic DNA (RAPD), simple sequence repeat (SSR), inter-retrotransposon amplified polymorphism (IRAP), inter-simple sequence repeat (ISSR), internal transcribed spacer (ITS), restriction fragment length polymorphism (RFLP), and amplified fragment length polymorphism (AFLP) analysis. These analyses have all been used for the genetic characterization and authentication of unicellular and multicellular organisms [1,2,3,4].

Litchi (Litchi chinensis Sonn., L. chinensis), belongs to the family Sapindaceae, and a tropical and subtropical evergreen tree from Hainan, Guangdong, and Fujian in China. It has been cultivated in China since 2000 B.C., and cultivated in many other parts of the world, particularly in Southeast Asia. Litchi is an edible fruit and is used in traditional medicine. As a traditional medicine, the fruit and its secondary metabolic products have been reported to have anticancer, anti-inflammatory, antifungal, antiviral, antioxidant, antiplatelet and anticoagulant, and antidiabetic activities [ 5, 6, 7, 8, 9, 10, 11, 12].

There are numerous litchi cultivars and therefore considerable confusion has arisen regarding their naming and identification. The same cultivar grown in different climates may produce different fruits. Cultivars also have different synonyms in various parts of the world. Therefore, the nutritional or medicinal values of litchi may vary. There are limited studies on genetic diversity of this edible and medicinal species. Recently, we characterized litchi cultivars by employing an improved RAPD and ISSR analysis [13].

Sequence-characterized amplified region (SCAR) markers are stable molecular markers derived from RAPD. The basic principle is to convert the dominant markers into co-dominant markers to reduce the tediousness of RAPD by molecular cloning [14,15,16]. SCAR markers usually have a high level of polymorphism owing to higher annealing temperatures, and longer primers with sequence specificity [17]. When RAPD is combined with SCAR markers, the procedure becomes a simple PCR analysis using PCR primers designed from the sequence of RAPD amplicons [13,16,17], as indicated in our earlier research [18,19,20,21]. In this study, we used DNA samples of L. chinensis collected from Fujian, Hainan, Guangdong, Guangxi and Sichuan, and a DNA sample of Dimocarpus confinis from Guangxi to improve RAPD amplification from our previous study [13]. The RAPD bands were cut and purified from agarose gel, followed by DNA ligation and sequencing. Then the SCAR markers were developed for authentication and validation of L. chinensis.

2. Materials and methods

2.1. DNA extraction of L. chinensis and other samples

DNA was extracted from fresh tender leaves of different samples of L. chinensis (Table 1) and other species by using a previously described slightly modified CTAB method, diluted with 1 × TE buffer to make the final concentration of 10 ng/µL, and stored at -20°C [3, 13, 18, 19].

 

Table 1. Sources of RAPD-SCAR samples for L. chinensis and D. confinis.

No. Species/cultivars Sources
1
D. confinis
Nanning, Guangxi
2
Heiye, L. chinensis
Quanzhou, Fujian
3
Longqiao, L. chinensis
Wanning, Hainan
4
Samyuehong, L. chinensis
Dongguan, Guangdong
5
Heli, L. chinensis
Yulin, Guangxi
6
Dahongpao, L. chinensis
Zhangba, Luzhou, Sichuan
7
Dahongpao, L. chinensis
Hejiang, Luzhou, Sichuan

 

2.2. Amplification of DNA by improved RAPD

In improved RAPD PCR, the DNA of L. chinensis and D. confinis was initially amplified using random primers SBC-I10, SBC-A12 and SBC-A16 and Tiangen reagents (Beijing, China). A total of 15 µL PCR reaction system consisted of 7.5 µL 2 × Taq PCR MasterMix, 1.5 µL 2.5 µM primer, 1.5 µL genomic DNA, and ddH2O. Amplification reactions were performed in an Applied Biosystems Veriti® 96-Well Thermal Cycler (Life Technology, USA) under the following program: initial denaturation at 95°C for 90 s, 40 cycles of denaturation at 94°C for 40 s, annealing at 36°C for 60 s with the RAMP rate from annealing to extension being 0.125°C/s (5% ramp rate), extension at 72°C for 90 s, and a final extension at 72°C for 5 min. PCR products were loaded into a 1.5% agarose gel for electrophoresis.

2.3. Cloning, identification and sequencing of DNA fragments

Three different bright bands were excised from the agarose gel and purified by using TIANgel Mini Purification Kit (DP209, China). Purified DNA fragments were ligated into pGM-T vector (No. VT202) (Tiangen Biotech, Beijing, China) and transformed into Escherichia coli (E. coli) DH5a competent cells. The recombinant clones were selected on LB agar plates, containing 100 µg/µL of ampicillin, 40 mg of X-gal and 160 µg of IPTG at 37°C overnight. The white colonies were screened out by the blue white screening method. The insertion was verified by PCR by using T7/SP6 primer pairs (T7 primer: 5'-TAATACGACTCACTATAGGG-3', SP6 primer: 5'-ATTTAGGTGACACTATAGAA-3'), and then by EcoR I digestion for a 1% agarose gel electrophoresis [ 18, 19, 20]. The cloned DNA fragments were then sequenced using the Sanger method.

2.4. Bioinformatics analysis by online program BLAST

The sequenced DNA was blasted in GenBank database by online on program (http://www.ncbi.nlm.nih.gov/BLAST/) to search for homologous sequences from different species and the homology analyzed.

2.5. Design of SCAR primers

The nucleotide sequence of each of the cloned RAPD fragment was used to design SCAR primers using online Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/primer3/). The sequences of primers, optimized PCR conditions and amplification lengths are listed in Table 2.

 

Table 2. Sequences of SCAR primers, PCR condition and product size.

SCAR 5'-primer Sequence (5'-3') 3'-primer Sequence (5'-3') Size (bp) Tm (°C)
L7 L7-16L AGCTGAGGGTGCATTACGAT L7-16R TGGCAAAGTCTGGTCTCAAA 197 60
L9 L9-6L TATCAAAAACGCAGCCGTTA L9-6R ACAGGACCCTTTCCAGACCT 246 60
L11 L11-26L TCCTTCAGGGATTCGTTTTG L11-26R GATCCCTACGACCATCTGGA 260 60

 

2.6. Development SCAR markers and SCAR analysis

To develop SCAR markers, the PCR amplification was performed using the DNA template from 11 different species, including six cultivars of L. chinensis and another 10 medicinal plants (13 samples in total). The 10 µL PCR reaction system was prepared as follows: 5 µL of 2L Taq PCR MasterMix, 1 µL of 2.5 µM SCAR primers, and 1 µL of genomic DNA (10 ng), with the remaining volumes filled by ddH2O. PCR was performed in an Applied Biosystems Veriti® 96-Well Thermal Cycler (Life Technology, USA) with an initial pre-denaturation for 90 s at 95°C followed by 35 cycles of denaturation at 94°C for 40 s, annealing at 60°C for 30 s, and extension at 72°C for 40 s. The final extension step was performed at 72°C for 5 min. The amplified PCR products were separated by electrophoresis on a 1.8% agarose gel in 1 × TAE buffer. Gels were visualized by 0.5 µg/mL ethidium bromide staining and the images documented using the ChemiDoc XRS (Bio-Rad, USA).

3. Results

3.1. Cloning of RAPD amplification fragments

Three RAPD primers SBC-I10 (I10), SBC-A12 (A12) and SBC-A16 (A16) were used for improved RAPD amplification in six samples of L. chinensis and one sample of D. confinis (Table 1) [13]. The results are shown in Fig. 1, where the blue arrows indicate the bands labeled with L7 by primer I10 (Fig. 1a), L9 by primer A12 (Fig. 1b) and L11 by primer A16 (Fig. 1c). The indicated bands were cut from the agarose gel and purified, and ligated to T-vector by AT cloning. The blue and white screening method was adopted firstly to screen the positive clones on LB agar plate (data not shown). The white clones were then identified by PCR amplification using SP6/T7 primer pair (Fig. 2a, b and c). The selected positive clones L7-16, L9-6 and L11-26 were finally identified by extraction of plasmid and DNA digestion by using EcoR I enzyme (Fig. 2d). In Fig. 2d, clone L7-16 is shown in lane 2 as an inserted DNA-fragment with ~ 250 bp in size, clone L9-6 is shown in lane 4 as two inserted DNA-fragments with ~ 550 bp and ~ 150 bp in size, and clone L11-26 is shown in lane 6 as an inserted DNA-fragment with ~ 400 bp in size, respectively. Clones L7-16, L9-6 and L11-26 were finally selected for Sanger sequencing.

Fig. 1.  RAPD products for cloning from litchi. (A) RAPD DNA fragment L7 from primer SBS-I10. The blue arrow indicates the band cut from an improved RAPD fragment. (B) RAPD DNA fragment L9 from primer SBS-A12. The blue arrow indicates the band cut from an improved RAPD fragment. (C) RAPD DNA fragment L11 from primer SBS-A16. The blue arrow indicates the band cut from an improved RAPD fragment. Lanes 1-7 indicate D. confinis or the L. chinensis cultivars listed in Table 1.

Fig. 2. Identification of positive clones of RAPD fragments. (A) Identification of RAPD DNA fragment L7 by bacteria PCR amplification with vector T7/SP6 primers. (B) Identification of RAPD DNA fragment L9 by bacteria PCR amplification with vector T7/SP6 primers. (C) Identification of RAPD DNA fragment L11 by bacteria PCR. The possible positive clones, L7-16 (red), L9-6 (red), and L11-26 (red), were selected for further plasmid extraction and DNA digestion. (D) Identification of positive clones L7-16, L9-6 and L11-26, respectively by plasmid DNA digestion by EcoR I. Lanes 1 and 2 indicate plasmid L7-16 without or with EcoR I digestion; lanes 3 and 4 indicate plasmid L9-6 without or with EcoR I digestion; and lanes 5 and 6 indicate plasmid L11-26 without or with EcoR I digestion. The blue arrows indicate expected bands of insert(s) ligated from RAPD DNA fragments. Lane M indicates the DNA molecular weight marker DL2000 with the fragment 2000, 1000, 750, 500, 250, and 100 bp.

 

3.2. Sequencing and characterization of L. chinensis-specific RAPD fragments

Sequencing of the above mentioned three cloned RAPD fragments of L. chinensis revealed that clone L7-16 consisted of 222 nucleotides, which was deposited into GenBank with accession number KM235222 (Fig. 3a); clone L9-6 consisted of 648 nucleotides, which was deposited into GenBank with accession number KM235223 (Fig. 3b); and clone L11-26 consisted of 369 nucleotides, which was deposited into GenBank with accession number KM235224 (Fig. 3c).

Fig. 3.  Cloned sequence by Sanger-sequencing. The sequences of clone L7-16 (A). The sequences of clone L9-6 (B). The sequences of clone L11-26 (C).

 

BLAST searches of the nucleotide sequences in GenBank database indicated that no clone showed any significant identity to that of any other species (data not shown).

3.3. Development of L. chinensis-specific SCAR markers, and analysis of the PCR amplicons in different species

To generate stable L. chinensis-specific diagnostic SCAR markers from RAPD markers, three pairs of primers (L7-16, L9-6 and L11-26) (Table 2) were designed and synthesized, based on cloned sequences (Fig. 3). The designed SCAR primer pairs were then used to amplify the genomic DNA from 24 of the collected DNA samples to test the species-specificity in amplification. The amplification results are shown in Fig. 4. The PCR results by SCAR marker L7-16 (Fig. 4a) indicated that the PCR products with expected size were observed only in two Luzhou samples of L. chinensis (Zhangba and Hejiang samples respectively), without any amplification in the other four L. chinensis samples or other species. This indicated that the SCAR marker L7-16 is Luzhou-specific. The lack of this specific amplicons in the L. chinensis samples from Fujian, Hainan, Guangdong, Guangxi, and other species samples indicates the efficacy of this marker in distinguishing the Luzhou samples from other cultivars or species. It should be clarified that one sample of Lonicera japonica (lane 24 in Fig. 4a) showed a weak band of bigger size than expected, which might be a non-specific band. From Fig. 4b, we found that the PCR products with expected size were observed in all six of L. chinensis samples amplified by SCAR markers L9-6, without any amplification found in other species, indicating that this SCAR marker is L. chinensis-specific. From Fig. 4c, we found that the PCR products with expected size were observed in four of the L. chinensis samples amplified by SCAR markers L11-26, without any amplification found in the other species and Zhangba sample, indicating that this SCAR marker is L. chinensis-specific. Negative controls without a DNA template did not show any PCR product (data not shown). Therefore, L. chinensis-specific SCAR markers were successfully developed, and can be used to authenticate individual cultivars.

Fig. 4. Development of SCAR markers of L7-16, L9-6 and L11-26, and analysis of the PCR amplicons of different species. (A) SCAR marker L7-16. B. SCAR marker L9-6. C. SCAR marker L11-26. Lanes 1-7 indicate D. confinis or L. chinensis cultivars listed in Table 1; Lanes 8-12 are samples of D. longan collected from Sichuan, Guangdong, Guangxi, Fujian, and Hainan, respectively; lanes 13 and 14 are samples of C. album from Sichuan and Fujian; lanes 15-17 are samples of G. lucidum; lane 18 is G. jasminoides; lane 19 is P. chinense from Gulin County in Sichuan; lane 20 is P. sedoides; lane 21 is V. philippica; lane 22 is G. elata from Liangshan City in Sichuan; lanes 23-24 are samples of the L. japonica from Leshan City of Sichuan and Shenzhen City of Guangdong. Lane M indicates the DNA molecular weight marker DL2000.

 

4. Discussion

In modern bio-molecular science, marker technologies have become significant tools. These technologies can help systematic biologists identify cultivars, species and populations [19]. RAPD is one of the frontline techniques, and in recent years, a number of plants or other organisms have been characterized by standard and improved RAPD analysis [3,13,21,22,23]. The technology has also been found to help study genetic diversity in newly found or modified species [24,25,26,27,28]. It has been reported that the conversion of RAPD markers into SCAR markers can improve their specificity and stability. This makes it more convenient and efficient in the analysis of different cultivars from different species [18,19]. As SCAR markers can identify a single or a few bands instead of a complex pattern, they are more accurate than RAPD, SSR, ISSR, RFLP, IRAP or AFLP alone. So the identification of organisms becomes more authentic and well-verified if RAPD analysis is combined with SCAR markers.

There are three methods for the screening of positive clones using molecular cloning: blue white screening, PCR of bacteria using T7/SP6 primers, and DNA digestion. Then Sanger sequencing is performed after verifying positive clones. The EcoR I digestion can be performed on plasmids because the pGM-T vector has two EcoR I sites at both sides near the ligation position. However, when the plasmid of clone L9-6 was digested by the EcoR I restriction enzyme, there were two inserted DNA-fragments about ~ 550 bp and ~ 150 bp in size (Fig. 2d, lane 4). This Sanger sequencing revealed that there was an EcoR I site inside the RAPD fragment.

D. confinis, also known as “longli” in Chinese, is similar in the morphology of tree and fruit with that of L. chinensis and Dimocarpus longan. D. confinis is a very ancient species in Guangxi, and was first described by Dacheng Fan in his book “Guihai Yuheng zhi” in 1162. A wild D. confinis variety from Guangxi was described previously [18]. However, it is difficult to distinguish D. confinis from L. chinensis and D. longan using plant morphology. In a recent study, improved RAPD analysis described the genetic distance between the samples of this plant collected from different locations in southern China [13]. In our study, we generated SCAR markers from the previously developed RAPD markers [13]. The SCAR markers L9-6 and L11-26 are specific to the DNAs from all six L. chinensis cultivars or five cultivars respectively, as they showed no PCR amplification in the DNA of other species, including D. confinis, D. longan, Canarium album, Ganoderma lucidum, Gardenia jasminoides, Penthorum chinense Pursh, Penthorum sedoides, Viola philippica, Gastrodia elata, and L. japonica. All three markers distinguished L. chinensis from D. confinis and D. longan, whereas marker L7-16 was found only in Luzhou samples. These findings confirm the results of our previous study, which revealed that Luzhou is geographically isolated from other regions, and therefore the two Luzhou samples were large genetically distant than the samples from other regions [13]. Some previous studies reported on the RAPD-SCAR technique for the characterization of other plants, such as D. longan [18] and L. japonica [19]. However, this is the first RAPD-SCAR study on L. chinensis.

5. Concluding remarks

In this study, we developed SCAR markers specific for the authentication of L. chinensis. The results of this study also indicate that the improved RAPD analysis has the potential for the genetic analysis of any species. The RAPD fragments can be cloned to generate to diagnostic SCAR markers that are stable and specific. Thus, the combination of the two techniques provides a simple and reliable tool for the genetic characterization of any plant species.

Financial support

This work was supported in part by the National Natural Science Foundation of China (81172049), Science and Technology Innovation Team of Colleges and Universities of Sichuan Province (13TD0032), Applied Basic Research Program of Science and Technology Department of Sichuan Province (14JC0797), and Luzhou City Special Foundation (2013LZLY-J10).

Conflict of interest

None.

Acknowledgments

The authors thank all individuals who provided plant leaves and DNA.

References

1. Agarwal M, Shrivastava N, Padh H. Advances in molecular marker techniques and their applications in plant sciences. Plant Cell Rep 2008;27:617-31. http://dx.doi.org/10.1007/s00299-008-0507-z.         [ Links ]

2. Liu W, Li L, Khan MA, Zhu F. Popular molecular markers in bacteria. Mol Gen Microbiol Virol 2012;27:103-7. http://dx.doi.org/10.3103/S0891416812030056.         [ Links ]

3. Fu J, Yang L, Khan MA, Mei Z. Genetic characterization and authentication of Lonicera japonica Thunb. by using improved RAPD analysis. Mol Biol Rep 2013;40:5993-9. http://dx.doi.org/10.1007/s11033-013-2703-3.         [ Links ]

4. Khadivi-Khub A, Soorni A. Comprehensive genetic discrimination of Leonurus cardiaca populations by AFLP, ISSR, RAPD and IRAP molecular markers. Mol Biol Rep 2014;41:4007-16. http://dx.doi.org/10.1007/s11033-014-3269-4.         [ Links ]

5. Hsu CP, Lin CC, Huang CC, Lin YH, Chou JC, Tsia YT, et al. Induction of apoptosis and cell cycle arrest in human colorectal carcinoma by Litchi seed extract. J Biomed Biotechnol 2012;2012:7. http://dx.doi.org/10.1155/2012/341479.         [ Links ]

6. Huang F, Zhang R, Yi Y, Tang X, Zhang M, Su D, et al. Comparison of physicochemical properties and immunomodulatory activity of polysaccharides from fresh and dried litchi pulp. Molecules 2014;19:3909-25. http://dx.doi.org/10.3390/molecules19043909.         [ Links ]

7. Xu L, Xue J, Wu P, Wang D, Lin L, Jiang Y, et al. Antifungal activity of hypothemycin against Peronophythora litchii in vitro and in vivo. J Agric Food Chem 2013;61: 10091-5. http://dx.doi.org/10.1021/jf4030882.         [ Links ]

8. Ichinose T, Musyoka TM, Watanabe K, Kobayashi N. Evaluation of antiviral activity of Oligonol, an extract of Litchi chinensis, against betanodavirus. Drug Discov Ther 2013;7:254-60. http://dx.doi.org/10.5582/ddt.2013.v7.6.254.         [ Links ]

9. Yang DJ, Chang YZ, Chen YC, Liu SC, Hsu CH, Lin JT. Antioxidant effect and active components of litchi (Litchi chinensis Sonn.) flower. Food Chem Toxicol 2012;50: 3056-61. http://dx.doi.org/10.1016/j.fct.2012.06.011.         [ Links ]

10. Sung YY, Yang WK, Kim HK. Antiplatelet, anticoagulant and fibrinolytic effects of Litchi chinensis Sonn. extract. Mol Med Rep 2012;5:721-4. http://dx.doi.org/10.3892/mmr.2011.735.         [ Links ]

11. Noh JS, Kim HY, Park CH, Fujii H, Yokozawa T. Hypolipidaemic and antioxidative effects of oligonol, a low-molecular-weight polyphenol derived from lychee fruit, on renal damage in type 2 diabetic mice. Br J Nutr 2010;104:1120-8. http://dx.doi.org/10.1017/S0007114510001819.         [ Links ]

12. Noh JS, Park CH, Yokozawa T. Treatment with oligonol, a low-molecular polyphenol derived from lychee fruit, attenuates diabetes-induced hepatic damage through regulation of oxidative stress and lipid metabolism. Br J Nutr 2011;106:1013-22. http://dx.doi.org/10.1017/S0007114511001322.         [ Links ]

13. Long Y, Cheng J, Mei Z, Zhao L, Wei C, Fu S, et al. Genetic analysis of litchi (Litchi chinensis Sonn.) in southern China by improved random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR). Mol Biol Rep 2014. http://dx.doi.org/10.1007/s11033-014-3755-8.         [ Links ]

14. Dnyaneshwar W, Preeti C, Kalpana J, Bhushan P. Development and application of RAPD-SCAR marker for identification of Phyllanthus emblica LINN. Biol Pharm Bull 2006;29:2313-6. http://dx.doi.org/10.1248/bpb.29.2313.         [ Links ]

15. Li SF, Tang SJ, Cai WQ. RAPD-SCAR markers for genetically improved NEWGIFT Nile Tilapia (Oreochromis niloticus niloticus L.) and their application in strain identification. Zool Res 2010;31:147-54. http://dx.doi.org/10.3724/SP.J.1141.2010.02147.         [ Links ]

16. Rajesh MK, Jerard BA, Preethi P, Thomas RJ, Fayas TP, Rachana KE, et al. Development of a RAPD-derived SCAR marker associated with tall-type palm trait in coconut. Sci Hortic 2013;150:312-6. http://dx.doi.org/10.1016/j.scienta.2012.11.023.         [ Links ]

17. Kumla S, Doolgindachbaporn S, Sudmoon R, Sattayasai N. Genetic variation, population structure and identification of yellow catfish, Mystus nemurus (C&V) in Thailand using RAPD, ISSR and SCAR marker. Mol Biol Rep 2012;39:5201-10. http://dx.doi.org/10.1007/s11033-011-1317-x.         [ Links ]

18. Yang L, Fu S, Khan MA, Zeng W, Fu J. Molecular cloning and development of RAPDSCAR markers for Dimocarpus longan variety authentication. SpringerPlus 2013;2: 501. http://dx.doi.org/10.1186/2193-1801-2-501.         [ Links ]

19. Yang L, Khan MA, Mei Z, Yang M, Zhang T, Wei C, et al. Development of RAPD-SCAR markers for Lonicera japonica Thunb. (Caprifolicaceae) variety authentication by improved RAPD and DNA cloning. Rev Biol Trop 2014;62:1649-57.         [ Links ]

20. Fu JJ. Short protocols in medical molecular biology. Beijing: China Medical Science Press; 2012.         [ Links ]

21. Mei Z, Fu S, Yu H, Yang L, Duan C, Liu X, et al. Genetic characterization and authentication of Dimocarpus longan Lour. using an improved RAPD technique. Genet Mol Res 2014;13:1447-55. http://dx.doi.org/10.4238/2014.March.6.3.         [ Links ]

22. Mei Z, Yang L, Zhang T, Yu H, Gan L, Zhang L, et al. Improved RAPD analysis of Canarium album (Lour.) raeusch from Sichuan province along Yangtze river in China. Annu Res Rev Biol 2014;4:51-60. http://dx.doi.org/10.9734/ARRB/2014/5015.         [ Links ]

23. Mei Z, Yang L, Khan MA, Yang M, Wei C, Yang W, et al. Genotyping of Ganoderma species by improved random amplified polymorphic DNA (RAPD) and inter-simple sequence repeat (ISSR) analysis. Biochem Syst Ecol 2014;56:40-8. http://dx.doi.org/10.1016/j.bse.2014.04.012.         [ Links ]

24. Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 1990;18:6531-5. http://dx.doi.org/10.1093/nar/18.22.6531.         [ Links ]

25. Noormohammadi Z, Hasheminejad-Ahangarani Y, Sheidai M, Ghasemzadeh-Baraki AS, Alishah O. Genetic diversity analysis in Opal cotton hybrids based on SSR, ISSR, and RAPD markers. Genet Mol Res 2013;12:256-69. http://dx.doi.org/10.4238/2013.January.30.12.         [ Links ]

26. Shakeel M, Ilyas M, Kazi M. Evaluation of synthetic hexaploid wheats (derivative of durum wheats and Aegilops tauschii accessions) for studying genetic diversity using randomly amplified polymorphic DNA (RAPD) markers. Mol Biol Rep 2013;40:21-6. http://dx.doi.org/10.1007/s11033-012-1943-y.         [ Links ]

27. Bhat AA, Haniffa MA, Divya PR, Gopalakrishnan A, Milton MJ, Kumar R, et al. Molecular characterization of eight Indian Snakehead species (Pisces: Perciformes Channidae) using RAPD markers. Mol Biol Rep 2012;39:4267-73. http://dx.doi.org/10.1007/s11033-011-1213-4.         [ Links ]

28. Velasco-Ramírez A, Torres-Morán MI, Molina-Moret S, Sánchez-González JJ, Santacruz- Ruvalcaba F. Efficiency of RAPD, ISSR, AFLP and ISTRmarkers for the detection of polymorphisms and genetic relationships in camote de cerro (Dioscorea spp.). Electron J Biotechnol 2014;17:65-71. http://dx.doi.org/10.1016/j.ejbt.2014.01.002.         [ Links ]


*Corresponding author: E-mail address: fujunjiang@hotmail.com (J. Fu).

Received 5 August 2014, Accepted 5 November 2014, Available online 4 December 2014

Copyright © 2015 Pontificia Universidad Católica de Valparaíso. Production and hosting by Elsevier B.V. All rights reserved. Peer review under responsibility of Pontificia Universidad Católica de Valparaíso.

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons