SciELO - Scientific Electronic Library Online

 
vol.18 issue3Overproduction of clavulanic acid by extractive fermentationMolecular cloning and antibacterial activity of hepcidin from Chinese rare minnow (Gobiocypris rarus) author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Electronic Journal of Biotechnology

On-line version ISSN 0717-3458

Electron. J. Biotechnol. vol.18 no.3 Valparaíso May 2015

http://dx.doi.org/10.1016/j.ejbt.2015.03.002 

RESEARCH ARTICLE

Stable expression and characterization of a fungal pectinase and bacterial peroxidase genes in tobacco chloroplast

 

Edward Alexander Espinoza-Sáncheza, Marianela Hazel Álvarez-Hernándeza, Jorge Ariel Torres-Castillob, Quintín Rascón-Cruzc, Adriana Gutiérrez-Díeza, Francisco Zavala-Garcíaa, Sugey Ramona Sinagawa-Garcíaa, *

a Laboratorio de Biotecnología, Campus de Ciencias Agropecuarias, Universidad Autónoma de Nuevo León, Francisco Villa S/N Col. Ex hacienda El Canadá, General Escobedo, Nuevo León, México
b Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipas, División del Golfo No. 356. Colonia Libertad, Cd. Victoria, Tamaulipas, México
c Laboratorio de Biotecnología I, Facultad de Ciencias Químicas, Universidad Autónoma de Chihuahua, Circuito 1, Nuevo Campus Universitario, Chihuahua, México


ABSTRACT

Background

The high capacity of chloroplast genome response to integrate and express transgenes at high levels makes this technology a good option to produce proteins of interest. This report presents the stable expression of Pectin lyase (PelA gene) and the first stable expression of manganese peroxidase (MnP-2 gene) from the chloroplast genome.

Results

pES4 and pES5 vectors were derived from pPV111A plasmid and contain the PelA and MnP-2 synthetic genes, respectively. Both genes are flanked by a synthetic rrn16S promoter and the 3'UTR from rbcL gene. Efficient gene integration into both inverted repeats of the intergenic region between rrn16S and 3'rps'12 was confirmed by Southern blot. Stable processing and expression of the RNA were confirmed by Northern blot analysis. Enzymatic activity was evaluated to detect expression and functionality of both enzymes. In general, mature plants showed more activity than young transplastomic plants. Compared to wild type plants, transplastomic events expressing pectin lyase exhibited enzymatic activity above 58.5% of total soluble protein at neutral pH and 60°C. In contrast, MnP-2 showed high activity at pH 6 with optimum temperature at 65°C. Neither transplastomic plant exhibited an abnormal phenotype.

Conclusion

This study demonstrated that hydrolytic genes PelA and MnP-2 could be integrated and expressed correctly from the chloroplast genome of tobacco plants. A whole plant, having ~ 470 g of biomass could feasibly yield 66,676.25 units of pectin or 21,715.46 units of manganese peroxidase. Also, this study provides new information about methods and strategies for the expression of enzymes with industrial value.

Keywords: Cell wall; Chloroplast genetic transformation; Hydrolytic enzyme; Nicotiana tabacum


 

1. Introduction

The plant cell wall is an important structure consisting of residues of cellulose, lignin, pectin and other polymers that support and confer impermeability to the cells; it also functions to prevent microbial attack [1], [2] and [3]. From these polymers, the pectate and lignocellulosic residues figure among the main wastes produced by the human activity in the form of wood, urban solid wastes, agricultural, grass and forestry wastes, although they are not toxic. Considering that the plant cell wall comprises more than 90% of dry weight, the accumulation of these products represents a focus of environmental deterioration and a loss of material potentially useful material [4], [5] and [6].

The cell wall components could be used if there were efficient extraction methods [5]. However, the heterogeneous nature of such wastes is the main obstacle for their use so new technological approaches are necessary to exploit these resources [7], [8] and [9]. In this sense, processes based on microorganisms are an alternative because their high efficiency in the processing of these materials, microorganisms have become an important source of enzymes used in genetic engineering [10].

Nevertheless, the chloroplast genetic engineering has been used to express proteins and has led to significant advances in plant biotechnology with a crucial role in plant genetic improvement in areas such as agriculture, food, medicine and environment [3] and [11]. This technology involves the transgene insertion into the chloroplast genome, which has several advantages as non-positional effects, absence of epigenetic effects and uniparental transgene inheritance [12], [13] and [14].

Transplastomic plants like tobacco ‘Nicotiana tabacum' [15], potato ‘Solanum tuberosum' [16], tomato ‘Solanum lycopersicum' [17], soybean ‘Glycine max' [18], cauliflower ‘Brassica oleracea' [19] and lettuce ‘Lactuca sativa' [20] and [21] have been successfully tested for expression of multiple proteins. Due to the high capacity of chloroplast to provide overexpression of up to 70% of total soluble protein (TSP), the possibility to express multiple transgene in operons as well as their efficiency in transgene contention, chloroplast transformation is a promising technology to obtain high level of enzymes with environmental and biotechnological impact — including lignocellulolytic enzymes such as Pectin lyase (EC 4.2.2.2) [3], [22] and [23].

Pectin lyase is a Ca2+dependent endoglucanase with multiples subfamilies (PL1, PL2, PL3, and PL9) [23], [24] and [25] which act as the virulence factors of microbial plant pathogens and are responsible for the a(1 ? 4)-bond degradation of polygalacturonic acid, a principal component of pectin. This reaction releases 4,5-unsaturated di and trigalacturonate from various pectates [26] and [27].

In the case of lignin, the principal component of secondary cell wall, some fungi have been shown to produce an enzyme cocktail (laccase ‘Lac', lignin peroxidase ‘LiP' and manganese peroxidase ‘MnP') capable of degrading lignin efficiently. The primary sequence of MnP exhibits high homology with other ligninases [28] and [29] removing an electron of phenol moiety of lignin to generate a phenoxy radical and oxidize Mn2 + to Mn3 + which is stabilized by organic acid chelators, facilitating the degradation of phenolic compounds in the presence of H2O2[30]. In this sense, lignin is the most important source of aromatic polymers in nature and its decomposition is necessary for carbon recycling, and therefore MnP activity is important for environmental conservation [31]. Although the expression of these enzymes has been reported in bacterial systems, there are few studies that focus on the production of hydrolytic enzymes in chloroplast compartments [3], [5], [32], [33] and [34].

In the present report, plastid biotechnology was used to express cell wall hydrolytic enzymes to study their expression, stability and biochemical activity in chloroplast compartments and the effect that would have on the metabolism and growth of plants as well as the segregation of the stable transgene.

2. Materials and methods

2.1. Cloning genes of interest into chloroplast expression vector

Two genes of cellulolytic enzymes were used: the pectin lyase gene (PelA) family 3 from Streptomyces thermocarboxydus [34] and the manganese peroxidase isozyme H3 gene (MnP-2) from Phanerochaete chrysosporium [35]. The sequences of each gene were designed in silico using Serial Cloner 2.6.1 software with undesirable restriction sites eliminated by silent mutation. Sequences were designed to reflect native codon usage of the chloroplast genome [36]. The sequences of PelA (GenBank: AB513441) and MnP-2 (GenBank: U10306) were synthesized by GeneScript (New Jersey, USA). The PelA cassette synthesized included the coding sequence (804 bp) flanked by the rrn16S promoter (P) and rbcL terminator (T), including a Shine-Dalgarno (SD) and a leader sequence (LS) of rbcL gene in the 5'UTR of the coding region of the gene (Prrn16S:SD: LS rbcl: PelA: TrbcL) [37]. The complete sequence was flanked with EcoRI/HindIII sites for cloning into the same sites in the pPRV111A vector [38]; additionally, the coding region of the PelA gene was flanked with recognition sites to enzymes 5'NheI/3'XbaI restriction sites to allow replacement in the vector by MnP-2 gene.

2.2. Plastid transformation

Tobacco plants (N. tabacum var. Petite Havana) were obtained from seeds germinated under sterile conditions on RM culture medium. For maintenance and propagation of plasmids Escherichia coli strain DH5a (Invitrogen®, Carlsbad CA, USA) was used. Plasmid DNA was obtained using QIAGEN Plasmid Maxi Kit columns (QIAGEN Inc., Valencia, CA). Gold particles of 0.6 µm (Bio-Rad®) coated with DNA were used for transformation and tobacco leaf bombardment according to Svab and Maliga [39] and Lutz et al. [40]. High-pressure gun S1000He Bio-Rad with a Hepta adapter (Bio-RAD, Germany, Munich) was used at 1100 psi and 11 cm shooting distance. Bombarded leaves were incubated for 24 h in dark, and after were cut in sections of 3 mm × 3 mm and placed on RMOP medium supplemented with 500 mg L- 1 of spectinomycin for a first selection round [39]; spontaneous mutants were eliminated with a second selection round on RMOP supplemented with 500 mg L- 1 of spectinomycin/streptomycin (Sigma-Aldrich, Japan) [39] and [41]. A third selection round was performed in RMOP medium to achieve a homoplasmy with spectinomycin. Finally, shoots from regenerated plants were placed on RM medium to promote rooting of plants. Plants of two months old were placed in pots with sphagnum moss until seed production.

2.3. Molecular analysis

Total DNA was extracted from leaves of tobacco plants according to Doyle [42]. PCR was performed using specific primers: PelA gene Fw-5'ATGACATCCGCGACACGA3' Rv-5'TGATGTCGGACGAGCTGTACT3' and MnP-2 gene Fw-5'ATGGCCTTTGCATCCTCA3' Rv-5'TTATGCAGGGCCGTTGAAC3', under the following conditions: 2 min of denaturing at 94°C, followed by 25 cycles of amplification (45 s at 94°C, 45 s at 60°C, 1 min at 72°C).

For Southern blot analysis 4 µg of DNA samples was digested with BamHI and then resolved in a 1% (w/v) of agarose gel at 65 V for 4 h. The agarose gels were denatured in 120 mM HCl for 30 min, followed for 30 min in 0.4 N NaOH and 0.6 M NaCl. Neutralization was performed with 0.5 M Tris pH 7.5 and 1.5 M NaCl. Transfer to nylon membranes (Blotting nylon type B positive, Fluka® Chemie GmbH, Steinheim, Germany) was performed with transference buffer (25 mM NaPO4, pH 6.5) after that membranes were fixed in a CL1000 Ultraviolet crosslinker at 120,000 µJ/cm2 for 12 s. Membranes were pre-hybridized at 55°C for 4 h and hybridized at 65°C for 12 h with 10 µL of a previously labeled rRNA16S probe by PCR digoxigenin-11-dUTP using Fw-5'TGAGAATGGATAAGAGGCTC3' Rv-5'TGTTGTTCCCCTCCCAAGGG3' primers.

To RNA analysis by Northern blot, total RNA from leaves of transplastomic and non-transplastomic plants was carried out using the LiCl protocol [43]. The Northern blots were performed as follows: 10 µg were resolved in a 0.8% (w/v) agarose/formaldehyde gel at 65 V for 2 h. The RNA was transferred overnight into nylon membranes by capillarity with 10 × SSC solution. The membranes were fixed in a CL1000 Ultraviolet crosslinker at 120,000 µJ/cm2 for 12 s. Pre-hybridization was performed at 50°C for 4 h followed by hybridization at 55°C for 12 h with 10 µL of labeled probe with PCR digoxigenin-11-dUTP using specific primers to each gene.

Both Southern and Northern blot membranes were washed twice during 15 min with 1 × of SSC, 0.1% SDS at RT, followed by three washes of 15 min with 0.2 × SSC, 0.1% SDS at 55°C. Anti-Digoxiginin-AP (Fab Fragments ‘Roche, Mannheim, Germany') 1:15,000 was used. Membranes were placed in the solution for 30 min and then washed with a washing buffer (100 mM Tris-HCl, pH 9.5, 100 M NaCl). For probe detection, 500 µL of DIG High Prime DNA Labeling and Detection Starter Kit II solution (Roche, Mannheim, Germany) were placed on membranes and revealed with Lumi-Film Chemiluminescent Detection Film (Roche, Mannheim, Germany).

2.4. Protein extraction

Leaves from young (three weeks old) and mature (seven weeks old) transplastomic and non-transplastomic plants were collected. Total soluble protein was extracted by homogenizing leaf samples in a buffer containing 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (pH 7.5), 1 mM ethylenediaminetetraacetic acid (EDTA), 10 mM potassium acetate, 5 mM magnesium acetate, 10 mM dithiothreitol (DTT) and 2 mM phenylmethylsulfonyl fluoride (PMSF) [5]. After centrifugation at 4500 rpm for 10 min and recovery of the upper phase twice, the protein concentration was determined by Bio-Rad Protein Assay Reagent Kit (Bradford's method) (Roth, Karlsruhe, Germany) using a BSA (Bovine Serum Albumin) calibration curve.

2.5. Enzymatic analysis

Pectin lyase activity was measured by the DNS method [44], quantifying the increase of sugar reducing groups liberated after incubation with 0.1 mL 1% Pectin from Citrus Peel (Sigma, Aldrich) as substrate dissolved in 100 mM Citrate buffer and 0.1 mL of protein extract for 1 h. The assay was carried out at pH 5, pH 7 (citrate: phosphate buffer) and pH 10 (Buffer citrate: phosphate adjust with NaOH) at 27, 45 and 60°C [45] and [46]. Additionally, the assay was carried out comparatively from young and mature plants. The concentration of reducing sugar present in the reaction was compared with a concentration curve by measuring the absorbance at 540 nm. A positive control of Pectinase from Aspergillus niger (Sigma, Aldrich) was used at the same assay condition. The enzyme activity was expressed as units per mg of TSP (U/mg), where one unit (U) of pectin lyase activity was defined as the amount of enzyme that liberates 1 µmoL of galacturonic acid per minute under the assay condition [47].

To MnP activity quantification the assay was realized by monitoring phenol red degradation [48] and [49]. Briefly, a final volume reaction mixture of 1 mL containing 20 mM sodium acetate-acetic acid buffer at pH 4.5, 6 and 8 was adjusted with NaOH, 25 mM lactate, 0.1 mM MnSO4, 0.5 mg BSA, 0.5 mg phenol red, 0.1 mM H2O2 and 0.1 mL of enzyme solution was used incubated at 30, 50 and 65°C. Assays were carried out to young and mature plants. The reaction was stopped after 10 min incubation with 100 µL of 10% NaOH. The absorbance was recorded at 610 nm and the activity expressed in U/mg with a molar extinction coefficient of the oxidized phenol red of 22 mM- 1 cm- 1. One activity unit is defined as the amount of enzyme necessary to oxidize 1 µmoL of substrate per minute under the assay conditions.

3. Results

3.1. Vector construction with PelA and MnP-2 genes

Two vectors (pES4 and pES5) were constructed in the pPRV111A plasmid backbone, containing PelA and MnP-2 genes, respectively. These vectors have rrn16S/3'rps12 sequences for integration via homologous recombination in the inverted repeat (IRA/IRB) of the chloroplast genome. The aadA gene (aminoglycoside 3'-adenylyltransferase) was also included as a selectable marker. The genes were cloned downstream of the aadA gene and flanked by 5'UTR from rrn16S and a 3'UTR from rbcl, for mRNA stabilization and to enhance gene translation [50]. Both promoter and terminator were synthetic and obtained from Kuroda and Maliga [37] performing point mutations in the 1216 bp corresponding at 3'UTR to eliminate the XbaI site (Fig. 1a and Fig. 1b).

Fig. 1. Restriction maps of the plastid transformation vectors. (a) pES4 vector containing PelA gene, (b) pES5 with MnP-2 gene for cloning in rrn16 and 3'rps12 homologous recombination site into chloroplast genome, these vectors contain aadA as selection marker gene. The genes are under control of an rrn16S promoter and rbcl terminator sequence.

 

3.2. Chloroplast transformation

pES4 and pES5 vectors containing the PelA and MnP-2 genes respectively were used to transform young tobacco leaves. The bombarded leaves were placed on RMOP regeneration medium to a first selection round. Spectinomycin-resistant regenerating explant appeared at five weeks (Fig. 2a). Leaves of these regenerated clones were cut in two-pieces and submitted to a second selection round on RMOP supplemented with spectinomycin/streptomycin to identify and discard non-transformed clones arising by mutation. Regeneration on both media occurred at two weeks confirming the transformation of these explants with a transformation efficiency of 3.14% for both vector. To achieve homoplasmy in plants, leaves from explants of the second selection round were placed in a third selection round and the resultant shoots were placed on RM medium non-supplemented to rooting of plants (Fig. 2b). Putative pES4 transformed plants were less developed in vitro compared with the wild type but the pES5 plants containing the MnP-2 gene showed larger internodes but less accumulated biomass.

Fig. 2. (a) Regenerating explant spectinomycin-resistant appeared at five weeks, (b) explants from third selection placed in RMOP medium supplemented with 500 mg L- 1 of spectinomycin, (c) PCR of both transformants lines showing amplification of specific genes, also show digoxigenin integration observed by molecular weight difference (NM: non-marked, digM: digoxigenin marked), (d) seedling spectinomycin-resistant from seed in RMOP medium with spectinomycin.

 

3.3. PCR analysis and plant acclimation in the greenhouse

The putative transformants of both lines were initially tested by PCR screening to detect the presence of our genes of interest (PelA and MnP-2). Four transplastomic plants were obtained from pES4 (NtpES4A, NtpES4B, NtpES4C and NtpES4D) transformation event whereas from pES5 transformation event seven transplastomic plants were obtained (NtpES5A, NtpES5B, NtpES5C, NtpES5D, NtpES5E, NtpES5F and NtpES5G). All plants were confirmed by PCR analysis showing the 0.804 kb and 1.115 kb fragments to the PelA and MnP-2 genes respectively (Fig. 2c). Transformants and non-transformed plants were transferred to pots and grown to maturity and flowering in greenhouse. The mature plants with PelA gene showed reduced growth compared with the wild type. However, the phenotype was similar to non-transformed plants, with respect to pigmentation, flowering time and floral phenotype (Fig. 3a and Fig. 3b). The transformed plants with Mnp-2 gene interestingly showed more growth than wild type plants in young and mature stage, with larger internodes and higher growth rate but biomass production in mature plants was lower than wild type plants such as was showed in vitro conditions. In spite of this, no pigmentation alterations were showed in leaves (Fig. 3c and Fig. 3d). Both lines (PelA and MnP-2 transformed plants) produced viable seed with germination at six days showing spectinomycin resistance (Fig. 2d). Seedlings of lines from both transformant lines showed fragments of similar size confirming gene segregation; this also indicates that spectinomycin-resistant phenotype is a reliable sign for the determination of transformants.

Fig.3. Transformants and untransformed plants from greenhouse compared in grown and flowering. (a) pES4 young plants transformed with PelA gene at three weeks old showed lower growth compared with the wild type but no affected significantly, (b) pES4 mature plants at seven weeks old showed normal phenotype, non-alteration on pigmentation and non-problems in the time flowering, the phenotype in flowers was normal, (c) pES5 young plants transformed with MnP-2 gene at three weeks old showed more growth that the wild type, with internodes more larges and higher growth rate, (d) pES5 mature plants at seven weeks old showed lower biomass production that wild type; no pigmentation alterations was showed in leaves.

 

3.4. Confirmation of integration, homoplasmy and transcription stability

To investigate if transplastomic lines achieve a state of homoplasmy, a Southern blot analysis was performed. The rRNA16S probe showed a 3 kb fragment in non-transformed line. In transplastomic lines, the probe showed a single fragment of 4.3 and 4.8 kb corresponding to PelA and MnP-2 lines confirming the efficient gene integration in the chloroplast genome. The absence of 3 kb fragments in both transformed lines suggests that all chloroplast genomes were transformed achieving homoplasmy (Fig. 4a). Also, to confirm the mRNA processing, Northern blot analysis was performed with total RNA from leaves of all transformed and non-transformed plants which confirmed stable monocistronic mRNA processing with transcripts of 0.804 kb and 1.115 kb corresponding to PelA and MnP-2 genes respectively (Fig. 4b and Fig. 4c).

Fig. 4. (a) Southern blot analysis from transplastomic plants (NtpES4A and NtpES5A) shown an efficient genes integration and homoplasmy into chloroplast genome, a 4.3 kb fragment of PelA gene and 4.8 kb fragment of MnP-2 gene were detected, untransformed plants a single 3 kb fragment was detected. (b, c) Northern blot analysis from transplastomic plants (NtpES4A and NtpES5A) shown transcription of mRNA in both genes ‘PelA: 0.804 kb and MnP-2 1.115 kb'.

3.5. Effect of pH, temperature on PelA and MnP-2 enzyme activity

For enzymatic activity assays, three plants from pES4 line (NtpES4A, NtpES4B, NtpES4C) and three plants of pES5 line (NtpES5A, NtpES5B, NtpES5C) were used and the results are shown as the average of each transplastomic line. Protein extracts were obtained from young and mature PelA and MnP-2 transformed plants; PelA activity was measured using Pectin from Citrus Peel as substrate; likewise, MnP activity was measured by monitoring phenol red degradation. In both transplastomic lines the enzymatic activity was upper in mature plants than young plants (Fig. 5a and Fig. 5d); in this respect, the leaves of mature plants were used to enzymatic assays. The enzymatic activity of PelA from transplastomic plants was higher than 19.72 ± 2.3 U/mg with respect to commercial pectinase from A. niger. Enzymatic activity from PelA showed that the activity of recombinant enzyme is high at neutral pH (60.6 ± 3.6 U/mg) decreasing at alkaline pH (pH 10) to 30.29 ± 1.85 U/mg. However, slightly acid pH is unfavorable with a high decreased activity to 12.99 ± 1.0 U/mg (Fig. 5b). On another hand, the temperature also plays a role in the activity performance with more activity at 60°C with 66.011 ± 4.9 U/mg decreasing to 53.65 ± 4.1 U/mg at 27°C but at 45°C had less activity decreasing 19.14 ± 2.1 U/mg, a difference of 46.86 U/mg with respect to optimum temperature (Fig. 5c). Enzymatic activity in MnP increased activity from acid pH (pH 4.5) (91.65 ± 5.6 U/mg) to pH 6 (103.47 ± 7.0 U/mg), but showed unfavorable activity in alkaline pH (pH 8) decreasing to 39.51 ± 7.3 U/mg (Fig. 5e). The temperature also had an influence on the activity performance showing increment activity according to the increase of temperature, of 42.40 ± 5.4 U/mg at 30°C until 113.0 ± 6.1 U/mg at 65°C (Fig. 5f). Both transplastomic lines showed higher levels of enzymatic activity with regard of non-transplastomic plants.

Fig. 5. Enzymatic activity of tobacco transplastomic plants. (a, d) Enzymatic activity of PelA and MnP-2 in young (three weeks old) and mature (seven weeks old) plants, (b, c) Enzymatic activity of PelA protein from the leaves of mature plants subjected at different pH and temperature conditions. (d, e) Enzymatic activity of MnP-2 protein from leaves of mature plants subjected at different pH and temperature conditions. The analysis showed more activity in transplastomic plants with respect at wild type plants in all conditions. The results are shown as average of three transplastomic plants (NtpES4A, B, C) and (NtpES5A, B, C).

 

3.6. Levels of PelA and MnP-2 activity in leaves

Pectin lyase protein activity (304 U g- 1 mature fresh leaves) was 55-fold more in transplastomic NtpES4 line than non-transformed plants (5.5 U g- 1 mature fresh leaves) with a yield of 66,676.25 units per plant. MnP protein activity (84.0 U g- 1 mature fresh leaves) was 22-fold more in transplastomic NtpES5 line than UT plants (3.7 U g- 1 mature fresh leaves) with a yield of 21,715.46 units per plant (Table 1).

 

Table 1. PelA and MnP-2 enzyme yield in transplastomic tobacco plants according to Jin et al. [22]. One unit of pectin lyase activity was defined as the amount of enzyme that liberates 1 µmoL of galacturonic acid per minute under the assay condition. One activity unit to MnP is defined as amount of enzyme necessary to oxidize 1 µmoL of substrate per minute under the assay conditions. The results are shown as average of three transplastomic plants (NtpES4A, B, C) and (NtpES5A, B, C).

Enzyme Leaf Age mg/mL mg/g U/mg Average of leaves per plant Average weight per leaf (g) Unit g- 1 in leaf Units Whole plant yield
Per leaf Per age group
PelA
Young
1.31 ± 0.07
5.2 ± 0.3
27.1 ± 2.8
8.3 ± 1.15
1.37 ± 0.28
142.7 ± 13.9
195.98
1632.53
Units
66,676.25
 
Mature
2.0 ± 0.17
8.3 ± 0.69
36.5 ± 2.2
12.3 ± 1.52
17.31 ± 4.43
304.6 ± 20
5275.24
65,043.72
MnP
Young
0.29 ± 0.01
1.1 ± 0.07
18.3 ± 1.8
6.3 ± 2.5
1.27 ± 0.16
21.5 ± 3.4
27.44
173.70
21,715.46
 
Mature
0.6 ± 0.06
2.6 ± 0.2
31.9 ± 2.4
15.3 ± 1.52
16.75 ± 1.25
83.8 ± 8.0
1405.20
21,541.75

 

4. Discussion

The production of multiple enzymes has been realized by different methods mainly chemical or through bacterial heterologous expression. In this sense, genetic industry can play an important role as a supplier of large amounts of proteins at low cost. Due to the high capacity of chloroplast genome response to direct the efficient expression of transgenes, multiple proteins of interest in agricultural sector have been expressed at high levels. In this study we report the stable expression of two hydrolytic genes (PelA and MnP-2) from the chloroplast genome. The rrn16S and 3'rps12 regions used as homologous recombination sites in the pPRV111A-derived expression vectors (pES4 and pES5) [38], efficiently promoted integration of the transgenes, as has been previously reported [3]. Moreover, the 5', 3'UTR and SD sequence were sufficient to express and stabilize of the mRNA. Therefore, these synthetic regulator elements were useful in directing the stable gene expression as reported by Kuroda and Maliga [37].

It has been reported that pectin lyases are involved in different roles within plants as cleavage pectin or defense against plant pathogens [3], [26] and [51]. Although there are reports of pectin lyase expression in different organisms [52], [53] and [54] there are few studies related to its expression in tobacco chloroplast; in this sense, we evaluated the enzymatic activity of a pectin lyase from S. thermocarboxydus strain B1 using commercial substrates finding high activity. The enzymatic activity was higher in transplastomic plants with respect to wild type, but the activity in different stages of transplastomic plants was also different with more activity in mature transplastomic when compared with transformed young plants as reported by Verma et al. [3]. Pectin lyase encoded by PelA gene showed more activity at neutral pH whereas at acid pH (pH 5) the enzyme activity was decreased until 78.5% contrary to the reported by Nakano [55]. Although it has been reported that alkaline pH is optimal for bacterial pectin lyases [45] and [56] our findings showed a decrease around 50% of activity at pH 10. Our results were similar to those reported by Verma et al. [3] who expressed the PelA, PelB and PelD genes from Fusarium solani in tobacco chloroplast and E. coli, and showed that optimal pH in E. coli was alkaline, whereas in plants the optimal pH was mildly acidic to neutral (6 to 7) with a 38% decline in activity at pH 10. Previously, Tonouchi et al. [34] expressed this PelA gene in E. coli with lower activity than the native enzymes; also, it is reported that heterologous protein was inactivated at 30°C. However, in this study using synthetic sequences 5' and 3'UTR (Prrn16S: SD: LS rbcl: GOI: TrbcL), we obtained more protein expression such as proposed by Kuroda and Maliga [37]. Furthermore, not only the expression was improved, the enzymatic activity was more efficient with stable activity at 60°C same as was showed to be the optimum temperature, these results adds at the reports of different optimal temperatures to pectin lyases [3], [45] and [58]. Nevertheless our results are higher than that reported by Tonouchi et al. [34] in E. coli, and also are less than native PL I (177 U/mg) [33].

Moreover, manganese peroxidase has been reported to intervene in the degradation of lignin facilitating the rupture of phenolic compound in H2O2 presence [30], [57] and [58]. Lignin-degrading enzymes from different organisms have been reported [58] and [59] and to our knowledge this is the first report about the expression of a Manganese Peroxidase isozyme H3 encoded by MnP-2 gene from P. chrysosporium in tobacco chloroplast. MnP-2 gene was inserted in the same region than PelA gene with stable expression. Plants of these lines showed higher activity in mature stage than in young stage, in a similar manner as we reported for PelA expression. The activity of this enzyme was evaluated at three different pH levels. We observed high activity at pH 6, as was reported by Jiang et al. [58] but in contrast with different reports showing high activity at pH 5.5 and pH 4.5 [60] and [61]. Alkaline pH was unfavorable with a decrease of 61.8% at pH 8, whereas a decrease of 11.4% was observed at acid pH. The enzymatic activity exhibited an optimum temperature at 65°C which decreased to 62.4% at 30°C. This differs from the previously reported temperatures of 37°C and 30°C in bacterial systems [58], [60] and [61].

Previously, the MnP gene from Coriolus versicolor controlled by double CaMV 35S-Promoter was transformed into tobacco using Agrobacterium, and resulted in 54-fold more activity than non-transformed plants [59], whereas in our study the lignin-degrading plant was 22-fold higher in transplastomic plants than wild type without differences in growth, flowering and seed production, unlike what has been previously seen in alfalfa [62] and tobacco [3] when this type of gene in expressed at this level.

The expression of different hydrolytic cell-wall genes in tobacco chloroplast has been achieved with different results. In this sense, some reports showed low effect in pigmentation with expression of a laccase gene [63] or severe retardation in plant growing when xylanase was expressed in the chloroplast genome [64]. In contrast, Petersen and Bock [5] found that expression of celluloses showed phenotypes with severe pigmentation loss followed by plant death. Beneficial results has been obtained with the hydrolytic gene expression such as the reported by Jin et al. [22] with expression of ß-glucosidase, resulting in elevated phytohormone levels, increase of biomass, increase trichomes and protection against aphids or whiteflies. Because of this, the absence of negative effects in growth and reproduction in transformed plants with both expressed genes in this study might be an advantage to express these genes in industrial and agricultural systems.

In this study, we demonstrated that hydrolytic genes such as PelA and MnP-2 could be integrated and expressed correctly in chloroplast genome tobacco plants. The resulting yield of hydrolytic enzymes demonstrated the viability harvesting protein from chloroplast-expressed genes: because a one plant has ~ 470 g of biomass, it is feasible to expect a yield of 66,676.25 units of pectin lyase and 21,715.46 units MnP per plant. These observations are in agreement with preliminary reports by Verma et al. [3] and Jin et al. [22] on hydrolytic enzymes. Likewise, genes with low expression in bacterial systems can be efficiently expressed with new concomitant sequences in plants and these systems might be used to produce hydrolytic enzyme involved in cell-wall degradation to treatment of residues as municipal wastes, agricultural or paper production. This study establishes the basis to develop novel methods and strategies to over-express enzymes implicated in pectin and lignin degradation, a potentially useful tool for biotechnological applications using transplastomic plants.

Financial support

This work was financially supported by the Consejo Nacional de Ciencia y Tecnología (CONACYT) through the project CB-2012-01179794.

Conflict of interests

The authors declare that there are no conflict of interest with Consejo Nacional de Cinecia y Tecnologia.

Acknowledgments

We would like to thank Dr. Pal Maliga, Waksman Institute, Rutgers University, USA for providing pPRV111A plasmid and Massimo Bosacchi for his critical reading of the manuscript and helpful comments.

References

1. Gray BN, Yang H, Ahner BA, Hanson MR. An efficient downstream box fusion allows high-level accumulation of active bacterial beta-glucosidase in tobacco chloroplasts. Plant Mol Biol 2011;76:345-55. http://dx.doi.org/10.1007/s11103-011-9743-7.         [ Links ]

2. SorianoM, Diaz P, Pastor FIJ. Pectate lyase C from Bacillus subtilis: A novel endo-cleaving enzyme with activity on highly methylated pectin. Microbiology 2006;152:617-25. http://dx.doi.org/10.1099/mic.0.28562-0.         [ Links ]

3. Verma D, Kanagaraj A, Jin S, Singh ND, Kolattukudy PE, Daniell H. Chloroplastderived enzyme cocktails hydrolyse lignocellulosic biomass and release fermentable sugars. Plant Biotechnol J 2010;8:332-50. http://dx.doi.org/10.1111/j.1467-7652.2009.00486.x.         [ Links ]

4. Hoondal GS, Tiwari RP, Tewari R, Dahiya N, Beg QK. Microbial alkaline pectinases and their industrial applications: A review. Appl Microbiol Biotechnol 2002;59:409-18. http://dx.doi.org/10.1007/s00253-002-1061-1.         [ Links ]

5. Petersen K, Bock R. High-level expression of a suite of thermostable cell walldegrading enzymes from the chloroplast genome. Plant Mol Biol 2011;76:311-21. http://dx.doi.org/10.1007/s11103-011-9742-8.         [ Links ]

6. Jung S, Lee DS, Kim YO, Joshi CP, Bae HJ. Improved recombinant cellulase expression in chloroplast of tobacco through promoter engineering and 5' amplification promoting sequence. Plant Mol Biol 2013;83:317-28. http://dx.doi.org/10.1007/s11103-013-0088-2.         [ Links ]

7. Bayer EA, Lamed R, Himmel ME. The potential of cellulases and cellulosomes for cellulosic waste management. Curr Opin Biotechnol 2007;18:237-45. http://dx.doi.org/10.1016/j.copbio.2007.04.004.         [ Links ]

8. Gomez LD, Steele-King CG, McQueen-Mason SJ. Sustainable liquid biofuels from biomass: The writing's on the walls. New Phytol 2008;178:473-85. http://dx.doi.org/10.1111/j.1469-8137.2008.02422.x.         [ Links ]

9. Cosgrove DJ. Growth of the plant cell wall. Nat Rev Mol Cell Biol 2005;6:850-61. http://dx.doi.org/10.1038/nrm1746.         [ Links ]

10. Wei H, Xu Q, Taylor LE, Baker JO, Tucker MP, Ding SY. Natural paradigms of plant cell wall degradation. Curr Opin Biotechnol 2009;20:330-8. http://dx.doi.org/10.1016/j.copbio.2009.05.008.         [ Links ]

11. Quesada-Vargas T, Ruiz ON, Daniell H. Characterization of heterologous multigene operons in transgenic chloroplasts: Transcription, processing, and translation. Plant Physiol 2005;138:1746-62. http://dx.doi.org/10.1104/pp.105.063040.         [ Links ]

12. Bock R. Plastid biotechnology: Prospects for herbicide and insect resistance, metabolic engineering and molecular farming. Curr Opin Biotechnol 2007;18:100-6. http://dx.doi.org/10.1016/j.copbio.2006.12.001.         [ Links ]

13. Daniell H, Ruiz ON, Dhingra A. Chloroplast genetic engineering to improve agronomic traits. Methods Mol Biol 2005;286:111-38. http://dx.doi.org/10.1385/1-59259-827-7:111.         [ Links ]

14. Maliga P. Plastid transformation in higher plants. Annu Rev Plant Biol 2004;55:289-313. http://dx.doi.org/10.1146/annurev.arplant.55.031903.141633.         [ Links ]

15. Svab Z, Hajdukiewicz P, Maliga P. Stable transformation of plastids in higher plants. Proc Natl Acad Sci U S A 1990;87:8526-30. http://dx.doi.org/10.1073/pnas.87.21.8526.         [ Links ]

16. Sidorov VA, Kasten D, Pang SZ, Hajdukiewicz PT, Staub JM, Nehra NS. Stable chloroplast transformation in potato: Use of green fluorescent protein as a plastid marker. Plant J 1999;19:209-16. http://dx.doi.org/10.1046/j.1365-313X.1999.00508.x.         [ Links ]

17. Ruf S, Hermann M, Berger IJ, Carrer H, Bock R. Stable genetic transformation of tomato plastids and expression of a foreign protein in fruit. Nat Biotechnol 2001;19:870-5. http://dx.doi.org/10.1038/nbt0901-870.         [ Links ]

18. Dufourmantel N, Pelissier B, Garcon F, Peltier G, Ferullo JM, Tissot G. Generation of fertile transplastomic soybean. Plant Mol Biol 2004;55:479-89. http://dx.doi.org/10.1007/s11103-004-0192-4.         [ Links ]

19. Nugent GD, Coyne S, Nguyen TT, Kavanagh TA, Dix PJ. Nuclear and plastid transformation of Brassica oleracea var. botrytis (cauliflower) using PEG-mediated uptake of DNA into protoplasts. Plant Sci 2006;170:135-42. http://dx.doi.org/10.1016/j.plantsci.2005.08.020.         [ Links ]

20. Lelivelt CLC,McCabeMS, Newell CA, deSnoo CB, VanDun KMP, Birch-Machin I, et al. Stable plastid transformation in lettuce (Lactuca sativa L.). PlantMol Biol 2005;58:763-74. http://dx.doi.org/10.1007/s11103-005-7704-8.         [ Links ]

21. Kanamoto H, Yamashita A, Asao H, Okumura S, Takase H, Hattori M, et al. Efficient and stable transformation of Lactuca sativa L. cv. Cisco (lettuce) plastids. Transgenic Res 2006;15:205-17. http://dx.doi.org/10.1007/s11248-005-3997-2.         [ Links ]

22. Jin S, Kanagaraj A, Verma D, Lange T, Daniell H. Release of hormones from conjugates: Chloroplast expression of β-glucosidase results in elevated phytohormone levels associated with significant increase in biomass and protection from aphids or whiteflies conferred by sucrose esters. Plant Physiol 2011;155:222-35. http://dx.doi.org/10.1104/pp.110.160754.         [ Links ]

23. Cantarel BL, Coutinho PM, Rancurel C, Bernard T, Lombard V, Henrissat B. The carbohydrate-active enzymes database (CAZy): An expert resource for glycogenomics. Nucleic Acids Res 2009;37:233-8. http://dx.doi.org/10.1093/nar/gkn663.         [ Links ]

24. Shevchik VE, Robert-Baudouy J,Hugouvieux-Cotte-PattatN. Pectate lyase PelI of Erwinia chrysanthemi 3937 belongs to a new family. J Bacteriol 1997;179:7321-30.         [ Links ]

25. Hassan S, Shevchik VE, Robert X,Hugouvieux-Cotte-Pattat N. PelN is a newpectate lyase of Dickeya dadantii with unusual characteristics. J Bacteriol 2013;195:2197-206. http://dx.doi.org/10.1128/jb.02118-12.         [ Links ]

26. Barras F, van Gijsegem F, Chatterjee AK. Extracellular enzymes and pathogenesis of soft-rot Erwinia. Annu Rev Phytopathol 1994;32:201-34. http://dx.doi.org/10.1146/annurev.py.32.090194.001221.         [ Links ]

27. Herron SR, Benen JAE, Scavetta RD, Visser J, Jurnak F. Structure and function of pectic enzymes: Virulence factors of plant pathogens. Proc Natl Acad Sci U S A 2000;97:8762-9. http://dx.doi.org/10.1073/pnas.97.16.8762.         [ Links ]

28. Gold MH, Alic M. Molecular biology of the lignin-degrading basidiomycete Phanerochaete chrysosporium. Microbiol Rev 1993;57:605-22.         [ Links ]

29. Irie T, Honda Y, Ha HC, Watanabe T, Kuwahara M. Isolation of cDNA and genomic fragments encoding the major manganese peroxidase isozyme from the white rot basidiomycete Pleurotus ostreatus. J Wood Sci 2000;46:230-3. http://dx.doi.org/10.1007/BF00776454.         [ Links ]

30. Nagai M, Sakamoto Y, Nakade K, Sato T. Isolation and characterization of the gene encoding amanganese peroxidase from Lentinula edodes.Mycoscience 2007;48:125-30. http://dx.doi.org/10.1007/s10267-006-0334-4.         [ Links ]

31. Wong DW. Structure and action mechanism of ligninolytic enzymes. Appl Biochem Biotechnol 2009;157:174-209. http://dx.doi.org/10.1007/s12010-008-8279-z.         [ Links ]

32. Kim JY, Kavas M, Fouad WM, Nong G, Preston JF, Altpeter F. Production of hyperthermostable GH10 xylanase Xyl10B from Thermotoga maritima in transplastomic plants enables complete hydrolysis of methylglucuronoxylan to fermentable sugars for biofuel production. Plant Mol Biol 2011;76:357-69. http://dx.doi.org/10.1007/s11103-010-9712-6.         [ Links ]

33. Miyairi K, Ogasawara A, Tonouchi A, Hosaka K, Kudou M, Okuno T. Low-molecularweight pectate lyase fromStreptomyces thermocarboxydus. J Appl Glycosci 2004;51:1-7. http://dx.doi.org/10.5458/jag.51.1.         [ Links ]

34. Tonouchi A, Hara Y, Umehara R, Sanuki T, Fukusawa T,Miyairi K. Cloning of the gene encoding an endo-acting pectate lyase from Streptomyces thermocarboxydus. Biosci Biotechnol Biochem 2010;74:433-6. http://dx.doi.org/10.1271/bbb.90693.         [ Links ]

35. Orth AB, Rzhetskaya M, Cullen D, Tien M. Characterization of a cDNA encoding a manganese peroxidase from Phanerochaete chrysosporium: Genomic organization of lignin and manganese peroxidase-encoding genes. Gene 1994;148:161-5. http://dx.doi.org/10.1016/0378-1119(94)90251-8.         [ Links ]

36. Sinagawa-Garcia SR, Tungsuchat-Huang T, Paredes-López O, Maliga P. Next generation synthetic vectors for transformation of the plastid genome of higher plants. Plant Mol Biol 2009;70:487-98. http://dx.doi.org/10.1007/s11103-009-9486-x.         [ Links ]

37. Kuroda H, Maliga P. Sequences downstreamof the translation initiation codon are important determinants of translation efficiency in chloroplasts. Plant Physiol 2001;125:430-6. http://dx.doi.org/10.1104/pp.125.1.430.         [ Links ]

38. Zoubenko OV, Allison LA, Svab Z, Maliga P. Efficient targeting of foreign genes into the tobacco plastid genome. Nucleic Acids Res 1994;22:3819-24. http://dx.doi.org/10.1093/nar/22.19.3819.         [ Links ]

39. Svab Z, Maliga P. High-frequency plastid transformation in tobacco by selection for a chimeric aadA gene. Proc Natl Acad Sci U S A 1993;90:913-7. http://dx.doi.org/10.1073/pnas.90.3.913.         [ Links ]

40. Lutz KA, Svab Z, Maliga P. Construction of marker-free transplastomic tobacco using the Cre-loxP site-specific recombination system. Nat Protoc 2006;1:900-10. http://dx.doi.org/10.1038/nprot.2006.118.         [ Links ]

41. Bock R. Transgenic plastids in basic research and plant biotechnology. J Mol Biol 2001;312:425-38. http://dx.doi.org/10.1006/jmbi.2001.4960.         [ Links ]

42. Doyle J. DNA protocols for plants. Mol Tech Taxon 1991;57:283-93. http://dx.doi.org/10.1007/978-3-642-83962-7_18.         [ Links ]

43. Stiekema WJ, Heidekamp F, Dirkse WG, Van BeckumJ, De Haan P, Bosch CT, et al.Molecular cloning and analysis of four potato tuber mRNAs. Plant Mol Biol 1988;11:255-69. http://dx.doi.org/10.1007/bf00027383.         [ Links ]

44. Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 1959;31:426-8. http://dx.doi.org/10.1021/ac60147a030.         [ Links ]

45. Wang H, Li X, Ma Y, Song J. Characterization and high-level expression of a metagenome-derived alkaline pectate lyase in recombinant Escherichia coli. Process Biochem 2014;49:69-76. http://dx.doi.org/10.1016/j.procbio.2013.10.001.         [ Links ]

46. Dosanjh NS, Hoondal GS. Production of constitutive, thermostable, hyper active exopectinase from Bacillus GK-8. Biotechnol Lett 1996;18:1435-8. http://dx.doi.org/10.1007/BF00129350.         [ Links ]

47. Beg QK, Bhushan B, Kapoor M, Hoondal GS. Production and characterization of thermostable xylanase and pectinase fromStreptomyces sp. QG-11-3. J IndMicrobiol Biotechnol 2000;24:396-402. http://dx.doi.org/10.1038/sj.jim.7000010.         [ Links ]

48. Rajan A, Kurup JG, Abraham TE. Solid state production of manganese peroxidases using arecanut husk as substrate. Braz Arch Biol Technol 2010;53:555-62. http://dx.doi.org/10.1590/S1516-89132010000300008.         [ Links ]

49. Glenn JK, Gold MH.Decolorization of several polymeric dyes by the lignin-degrading basidiomycete Phanerochaete chrysosporium. Appl Environ Microbiol 1983;45:1741-7.         [ Links ]

50. Watson J, Koya V, Leppla SH, DaniellH. Expression of Bacillus anthracis protective antigen in transgenic chloroplasts of tobacco, a non-food/feed crop. Vaccine 2004;22:4374-84. http://dx.doi.org/10.1016/j.vaccine.2004.01.069.         [ Links ]

51. Wegener CB, Olsen O. Heterologous pectate lyase isoenzymes are not different in their effects on soft rot resistance in transgenic potatoes. Physiol Mol Plant Pathol 2004;65:59-66. http://dx.doi.org/10.1016/j.pmpp.2004.12.004.         [ Links ]

52. Shih J,Wei Y, Goodwin PH. A comparison of the pectate lyase genes, pel-1 and pel-2, of Colletotrichum gloeosporioides f.sp. malvae and the relationship between their expression in culture and during necrotrophic infection. Gene 2000;243:139-50. http://dx.doi.org/10.1016/S0378-1119(99)00546-6.         [ Links ]

53. Chotigeat W, Duangchu S, Wititsuwannakun R, Phongdara A. Cloning and characterization of pectate lyase from Hevea brasiliensis. Plant Physiol Biochem 2009;47:243-7. http://dx.doi.org/10.1016/j.plaphy.2008.12.008.         [ Links ]

54. Brühlmann F, Keen NT. Cloning, sequence and expression of the pel gene from an Amycolata sp. Gene 1997;202:45-51. http://dx.doi.org/10.1016/S0378-1119(97)00449-6.         [ Links ]

55. Nakano Y, Uenoyama M, Kobayashi E. Pectin lyase, pectin lyase gene, enzyme preparation, andmethod for production of single cells of plant tissue. Google Patents US20120220016 A1; 2012.         [ Links ]

56. Tardy F, Nasser W, Robert-Baudouy J, Hugouvieux-Cotte-Pattat N. Comparative analysis of the fivemajor Erwinia chrysanthemi pectate lyases: Enzyme characteristics and potential inhibitors. J Bacteriol 1997;179:2503-11.         [ Links ]

57. Scheel T, Höfer M, Ludwig S, Hölker U. Differential expression of manganese peroxidase and laccase in white-rot fungi in the presence ofmanganese or aromatic compounds. Appl Microbiol Biotechnol 2000;54:686-91. http://dx.doi.org/10.1007/s002530000427.         [ Links ]

58. Jiang F, Kongsaeree P, Schilke K, Lajoie C, Kelly C. Effects of pH and temperature on recombinant manganese peroxidase production and stability. Appl Microbiol Biotechnol 2008;146:15-27. http://dx.doi.org/10.1007/s12010-007-8039-5.         [ Links ]

59. Limura Y, Ikeda S, Sonoki T, Hayakawa T, Kajita S, Kimbara K, et al. Expression of a gene for Mn-peroxidase from Coriolus versicolor in transgenic tobacco generates potential tools for phytoremediation. Appl Microbiol Biotechnol 2002;59:246-51. http://dx.doi.org/10.1007/s00253-002-1008-6.         [ Links ]

60. Sutherland GRJ, Aust SD. The effects of calcium on the thermal stability and activity of manganese peroxidase. Arch Biochem Biophys 1996;332:128-34. http://dx.doi.org/10.1006/abbi.1996.0324.         [ Links ]

61. Urek RO, Pazarlioglu NK. Purification and partial characterization of manganese peroxidase from immobilized Phanerochaete chrysosporium. Process Biochem 2004;39:2061-8. http://dx.doi.org/10.1016/j.procbio.2003.10.015.         [ Links ]

62. Austin S, Bingham ET, Mathews DE, Shahan MN, Will J, Burgess RR. Production and field performance of transgenic alfalfa (Medicago sativa L.) expressing alpha-amylase and manganese-dependent lignin peroxidase. Euphytica 1995;85:381-93. http://dx.doi.org/10.1007/BF00023971.         [ Links ]

63. Davarpanah S, Ahn JW, Ko SM, Jung SH, Park YII, Liu JR, et al. Stable expression of a fungal laccase protein using transplastomic tobacco. Plant Biotechnol Rep 2012;6:305-12. http://dx.doi.org/10.1007/s11816-012-0225-4.         [ Links ]

64. Kolotilin I, Kaldis A, Pereira EO, Laberge S,Menassa R. Optimization of transplastomic production of hemicellulases in tobacco: Effects of expression cassette configuration and tobacco cultivar used as production platform on recombinant protein yields. Biotechnol Biofuels 2013;6:65. http://dx.doi.org/10.1186/1754-6834-6-65.         [ Links ]


*Corresponding author: E-mail address: ssinagawa@gmail.com (S.R. Sinagawa-García).

Received 21 November 2014, Accepted 2 February 2015, Available online 1 April 2015

Copyright © 2015 Pontificia Universidad Católica de Valparaíso. Production and hosting by Elsevier B.V. All rights reserved. Peer review under responsibility of Pontificia Universidad Católica de Valparaíso.

 

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License