SciELO - Scientific Electronic Library Online

 
vol.49 issue4Assessment of an east-west phenotypic variation in body height, body form and body mass among prehistoric hunter-gatherers of Patagonia and Tierra del Fuego, chile author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Chungará (Arica)

On-line version ISSN 0717-7356

Chungará (Arica) vol.49 no.4 Arica Dec. 2017

http://dx.doi.org/10.4067/S0717-73562017005000028 

Bioantropología

¿PUEDE EL ADN MITOCONDRIAL PROPORCIONAR INFORMACIÓN SOBRE LA ETNOGÉNESIS DE LOS PUEBLOS ORIGINARIOS CHILENOS?

CAN MITOCHONDRIAL DNA PROVIDE INFORMATION ON THE ETHNOGENESIS OF CHILEAN NATIVE POPULATIONS?

Francisco Rothhammer1 

Giannina Puddu1 

Macarena Fuentes-Guajardo2  3 

1Instituto de Alta Investigación, Universidad de Tarapacá, Antofagasta 1520 Arica, Chile. franciscorothhammer@gmail.com; ninapuddu@gmail.com

2Department of Genetics, Evolution and Environment, and Genetics Institute, University College London, London, WC1E 6BT, United Kingdom. Macarena.fuentes.guajardo@gmail.com

3Departamento de Tecnología Médica, Facultad de Ciencias de la Salud, Universidad de Tarapacá, Arica, Chile.

Resumen:

A pesar del esfuerzo realizado por numerosos investigadores, el conocimiento existente acerca del origen de la mayoría de los pue- blos originarios chilenos continúa siendo fragmentario y parcialmente contradictorio. En consecuencia nos hemos propuesto como objetivo contribuir al esclarecimiento de este importante aspecto de la historia del pueblo chileno, ofreciendo un enfoque desde la perspectiva de la genética histórica. Examinamos, en primer lugar, la variación que presentan los haplogrupos pan-americanos de ADN mitocondrial (A, B, C y D) de poblaciones actuales de cinco regiones naturales de Chile continental: Norte Grande, Norte Chico, Zona Central, Zona Sur y Zona Austral. Al evaluar la distribución de hombres y mujeres de origen ancestral americano se observa una predominancia de mujeres sobre hombres, contrastando este hecho con la distribución de géneros en el grupo de origen europeo, donde se observa consistentemente predominancia del sexo masculino. Luego calculamos distancias genéticas entre representantes de diferentes grupos originarios del cono sur, las regiones naturales de Chile y poblaciones mixtas de Brasil, Bolivia, Perú y Argentina. Las distancias genéticas obtenidas indican, como era de esperar, proximidad genética entre los pueblos quechua, aimara, y atacameño y el Norte Grande y entre pehuenches, mapuches, huilliches, tehuelches, alacalufes, yaganes y onas y la Zona Sur y Austral y sugieren desplazamientos y mezcla poblacional de grupos de la Amazonia, los Andes Centrales, Chile y Argentina, que tomados en conjunto, contribuyen a entender con mayor claridad el origen geográfico de los grupos étnicos chilenos.

Palabras claves: pueblos originarios; ADNmt; distancias genéticas; poblaciones latinoamericanas

Abstract:

Despite efforts made by numerous researchers, existing knowledge about the origin of the majority of Chilean ethnic populations continues to be fragmentary and partially contradictory. Our aim is to contribute to the clarification of this important aspect of Chilean history, from the perspective of historical genetics. We first examine the variation of pan-American haplogroups of mitochondrial DNA (A, B, C and D) in five natural regions of continental Chile: Norte Grande (Far North), Norte Chico (Near North), Central Zone, Southern Zone and Southernmost Zone. When evaluating the distribution of men and women of American ancestral origin, the predominance of women over men is noticeable. In contrast, when the gender distribution of individuals of European ancestral origin is analyzed, male predominance is consistently observed. Next we calculated genetic distances between representatives of different ethnic groups of the southern cone of South America, the natural regions of Chile and mixed populations of Brazil, Bolivia, Peru and Argentina. As expected, genetic distances indicate proximity between Quechua, Aymara, and Atacameño and the Norte Grande, and between Pehuenche, Mapuche, Huilliche, Tehuelche, Alacalufe, Yagan and Ona and the Southern and Southernmost Zone. In addition, displacements of groups and population mixing involving the Amazon, Central Andes and Argentina are revealed, contributing to a clearer understanding of the geographical origin of Chilean ethnic groups.

Key words: Native peoples; mtDNA; genetic distances; Latin American populations

Si bien la ley indígena chilena (Ley Nº 19.253) que fue promulgada el 28.09.1993 y publicada el 05.10.1993 específicamente se refiere a los indígenas, sus culturas y sus comunidades y reconoce como principales etnias indígenas de Chile a las comunidades mapuche, aimara, rapa nui o pascuense, atacameña, quechua, colla, diaguita, kawashkar, alacalufe y yámana o yagán, existe incertidumbre acerca del origen y los lazos de parentesco existentes entre estos pueblos originarios. Llama la atención que incluso con respecto al grupo originario americano más numeroso de Chile, el pueblo mapuche, no exista claridad de sus orígenes. Oswald Menghin, antropólogo austríaco, sustentando su hipótesis en rasgos culturales, propuso en 1909 que los mapuches tuvieron su origen en la Amazonia, desde donde habrían migrado a Chile pasando por Argentina y luego cruzando la cordillera de Los Andes (Menghin 1962). Ricardo E. Latcham postuló en 1921 un modelo algo más complejo que incluía migraciones costeras del norte de Chile, coincidiendo sin embargo con Menghin en el origen amazónico, el paso por Argentina y el cruce de la cordillera de Los Andes (Latcham 1928). Posteriormente, las ideas de Latcham serían apoyadas por el historiador Francisco Antonio Encina. Tomás Guevara en 1925, propuso también un desplazamiento de norte a sur de grupos mariscadores y pescadores que manifestaban, según este autor, diferencias culturales explicables por el contacto con pueblos extranjeros invasores (Guevara 1929). La arqueóloga Grete Mostny sostuvo en su libro Prehistoria de Chile que las primeras manifestaciones agroalfareras descubiertas en la región meridional estaban vinculadas con hallazgos arqueológicos realizados en la zona de los valles transversales relacionados con la cultura El Molle y a través de esta última con las culturas tempranas del noroeste argentino (Mostny 1954). A mediados de los años ochenta nuestro grupo de trabajo postuló una hipótesis provisional sobre el poblamiento de Chile basada esta vez en medidas craneométricas, que confirmaba la existencia de corrientes migratorias de norte a sur planteadas con anterioridad (Rothhammer et al. 1986). Posteriormente, el historiador Roberto E. Porcel sostuvo que los mapuches eran grupos descendientes de aimaras que se desplazaron desde Perú al sur de Chile como consecuencia de las guerras entre el Antisuyo y el Contisuyo, siendo los pehuenches y los tehuelches originariamente argentinos (Porcel 2007). Por último, aplicando un enfoque multidisciplinario que incluyó información genética y cultural, Dillehay y Rothhammer (2013) resumieron recientemente el estado del conocimiento acerca de los orígenes de la etnia mapuche. A pesar del esfuerzo realizado por todos estos investigadores, el conocimiento existente del origen de la mayoría de los pueblos originarios continúa siendo parcialmente fragmentario y en parte contradictorio. En consecuencia, nos hemos propuesto contribuir al esclarecimiento de este importante aspecto de la historia del pueblo chileno ofreciendo un enfoque desde la perspectiva de la genética histórica.

Como es sabido, el ADNmt fue descubierto en 1963 (Nass y Nass 1963) y secuenciado en 1981 (Anderson et al. 1981). Es una molécula circular, caracterizada por presentar altas tasas de mutación y ser heredada por línea materna. El ADNmt ha sido utilizado en diferentes áreas de investigación científica tales como la composición genética de poblaciones humanas actuales, el análisis genético de restos esqueletales, las migraciones humanas e importantes aplicaciones médico-forenses como la identificación de personas, entre otras (Catelli et al. 2011). Debido a que el ADNmt solo se transmite por línea materna, ha sido posible trazar la ascendencia matrilineal hasta los orígenes de la especie humana en África y desde allí su correspondiente división y dispersión por toda la superficie de la tierra, lo cual ha servido de base para la elaboración de teorías sobre migración y poblamiento del planeta. Se han encontrado variantes de ADNmt humano que son características de algunas poblaciones llamados haplogrupos. Estudios realizados en poblaciones americanas revelaron la existencia de variantes denominados haplogrupos pan-americanos representadas por las letras A, B, C, D y X. Centraremos nuestra atención en los cuatro más frecuentes que presentan en diferentes grupos étnicos chilenos frecuencias significativamente diferentes.

Materiales y Métodos

Se obtuvo una muestra de 421 individuos, que incluye en forma proporcional a individuos nacidos en las 15 Regiones de Chile. Las y los voluntarios fueron invitados a participar en este estudio mediante charlas, folletos y afiches. Se informó detalladamente a cada voluntario de los objetivos y procedimientos del estudio y se le invitó a firmar un consentimiento informado aprobado por el Comité de Ética/Bioética de la Universidad de Tarapacá.

Después de solicitar información sobre el nombre completo, lugar de nacimiento, nivel educacional, ancestría e información médica, se obtuvo una muestra de 10 cc de sangre venosa de la cual se extrajo ADN genómico mediante el protocolo de extracción de Lahiri y Nurnberger. Este es un método de extracción por salting out, que a partir de sangre completa consigue eliminar proteínas celulares mediante la deshidratación y precipitación con buffers y soluciones saturadas de cloruro de sodio (Lahiri et al. 1991). Los polimorfismos presentes en el ADNmt, que corresponden a los haplogrupos pan-americanos, fueron amplificados mediante la técnica de PCR (Polymerase Chain Reaction) en un

volumen final de 50 ul, utilizando Platinum PCR SuperMix (Invitrogen), 300 ng de ADN genómico y los siguientes partidores específicos:

Haplogroupo A:L604

GTAGCTTACCTCCTCAAAGCAAH708

AGGGTGAACTCACTGGAACG

Haplogroupo B:L8214

CACAGTTTCATGCCCATCGTH8294

ATGCTAAGTTAGCTTTACAGTGG

Haplogroupo C:L13232

CGCCCTTACACAAAATGACATCAAH13344

GGAGCACATAAATAGTATGGC

Haplogroupo D:L5120

CCTAACTACTACCGAATTCCTAH5255

ATTCTTCGATAATGGCCCATTTG

El PCR fue realizado bajo las siguientes condiciones: 1 ciclo a 95º C por 5 minutos, seguido por 35 ciclos a 95º C por 45 segundos, 55º C por 1 minuto y 72º C por 1 minuto y finalmente un ciclo a 72º C por 5 minutos). Los haplogrupos A, C y D fueron obtenidos utilizando enzimas de restricción específicas para cada haplogrupo: Hae III para haplogrupo A, Hinc II para haplogrupo C y Alu I para el haplogrupo D. El haplotipo B se detectó mediante la observación directa del producto de la amplificación, ya que este haplogrupo presenta una deleción de nueve pares de bases en la región intergénica COII/tRNALYs. Las digestiones como la determinación del haplogrupo B se analizaron mediante electroforesis en gel de agarosa al 2% (TAEx1).

Debido a que para algunas regiones geopolíticas el número de individuos resultó ser reducido, la muestra obtenida fue reagrupada en cinco regiones naturales (RN) de Chile continental: Norte Grande, Norte Chico, Zona Central, Zona Sur y Zona Austral, utilizando criterios de la Corporación de Fomento de la Producción (CORFO), con el propósito de obtener la distribución de las frecuencias de haplogrupos pan-americanos de la población chilena.

Cabe recordar que debido a que el ADNmt es un marcador genético uniparental, el aporte genético femenino y masculino varía para cada RN de Chile. Con base en los haplogrupos de ADNmt pan-americanos, que permiten cuantificar el aporte femenino y un conjunto de marcadores informativos de ancestría (en inglés ancestry informative markers o AIM’s) que inicialmente fueron seleccionados de un conjunto de más de 750.000 polimorfismos uninucleotídicos (en inglés single nucleotide polymorphisms o SNP’s), con el objeto de calcular los porcentajes de ancestría americana y europea de la población chilena (Fuentes et al. 2014).

Posibles rutas migratorias utilizadas por los ancestros de los grupos originarios chilenos se reconstruyeron calculando distancias genéticas (Fst) entre quechuas, aimaras, atacameños, changos, pehuenches, mapuches, huilliches, tehuelches, alacalufes, yaganes y onas, que fueron obtenidas con base en frecuencias de haplogrupos publicadas en su mayoría como resultado de numerosos trabajos de terreno, análisis de laboratorio y evaluaciones estadísticas en que participaron activamente Eugenio Aspillaga, Mónica Acuña, Pilar Carvallo, Zury Harb, Elena Llop, Mauricio Moraga, Rodrigo Moreno y Hernán Palomino, todos en algún momento integrantes del grupo de genética de poblaciones del Programa de Genética Humana de la Facultad de Medicina de la Universidad de Chile. En una segunda etapa el análisis se amplió incluyendo las RN de Chile y haplogrupos publicados de poblaciones mixtas de regiones naturales de Brasil, Bolivia, Perú y Argentina, que podrían eventualmente ser consideradas como lugares de origen de los grupos étnicos chilenos. Las frecuencias de haplogrupos se obtuvieron de Alves-Silva et al. 2000; Bisso- Machado et al. 2012; Cabana et al. 2014; Catelli et al. 2011; de la Fuente et al. 2015; García-Bour, et al. 2004; Lalueza et al. 1995; Moraga et al. 2000; Moraga et al. 2016; Merriwether et al. 1995; Rocco et al. 2002 y Taboada-Echalar et al. 2013.

Las distancias genéticas Fst y el análisis de varianza molecular (AMOVA), para determinar la significación estadística de la variación observada, fueron obtenidos utilizando el programa computacional Arlequin 3.5 (Excoffier y Lischer 2010).

Resultados

En términos generales la distribución de haplogrupos pan-americanos en Chile presenta un patrón de variación que indica un poblamiento inicial de norte a sur. El haplogrupo A se encuentra en porcentajes marginalmente bajos en la mayor parte del territorio nacional con excepción del Norte Chico. En el extremo norte se evidencia un predominio de los haplogrupos B y C. El haplogrupo B disminuye de norte a sur y ausente en la Zona Austral. El haplogrupo C muestra bastante variabilidad a lo largo del territorio y el haplogrupo D aumenta de frecuencia de norte a sur, siendo el haplogrupo dominante en las RN Sur y Austral (Tabla 1).

Tabla 1 Distribución de haplogrupos panamericanos de ADNmt en cinco regiones naturales de Chile. Distribution of pan-American mtDNA haplogroups in five natural regions of Chile. 

La reconstrucción aproximada de los aportes genéticos femeninos y masculinos de origen americano y europeo a la población chilena indica que al evaluar la contribución americana se observa una predominancia femenina. En contraste, al analizar el aporte europeo, se observa consistentemente predominancia masculina en todas las RN de Chile (Tabla 2).

Estos resultados (chi-cuadrado 21,66; P=0,0415) demuestran que gran parte de la composición genética de la población chilena proviene de la mezcla de mujeres de origen americano con hombres de origen europeo. Al comparar los promedios de mezcla americana de las RN de Chile calculadas con base en ADNmt y AIM’s se observan diferencias que promedian un 38%. El Norte Grande presenta un porcentaje de 27% demostrando menor asimetría con respecto al origen americano y europeo de hombres y mujeres. En resumen, las diferencias indican que en promedio un 86% de los chilenos podría tener una madre americana y un padre de origen europeo.

Tabla 2 Aporte femenino y masculino de origen americano y europeo a la población chilena. American and European female and male contribution to the Chilean population. 

Con el objeto de definir posibles vías migratorias utilizadas durante la colonización de América del Sur que guarden relación con el origen de los grupos étnicos chilenos, se realizaron cálculos de distancias genéticas (Fst) entre grupos originarios del cono sur definidos con base en características culturales, fundamentalmente linguísticas (Tabla 3). Se observan valores bajos entre los pueblos quechua, atacameño y chango, observándose distancias algo mayores entre quechuas y aimaras. Los atacameños ocupan una posición intermedia presentando distancias genéticas bajas con quechuas y aimaras. Por otra parte, pehuenches, mapuches, huilliches, tehuelches, yaganes y onas exhiben distancias pequeñas alejándose los alacalufes. Los huilliches son genéticamente indistinguibles de los tehuelches. Resulta igualmente interesante analizar las distancias que los pueblos originarios presentan con las poblaciones de las RN de Chile y con individuos que habitan regiones geográficas de América del Sur, que pueden ser consideradas como posibles lugares de origen de los grupos étnicos chilenos tales como Brasil (noroeste), Brasil (noreste), Bolivia (tierras altas), Bolivia (tierras bajas), Perú, Argentina (norte) y Argentina (Sur) (Tabla 4).

Tabla 3 Distancias Fst entre pueblos originarios de Chile y Argentina. Fst distances between native populations from Chile and Argentina. 

Quechua Aimara Atacameño Chango Pehuenche Mapuche Huilliche Alacalufe Yagan Ona Tehuelche
Quechua 0
Aimara 0,081 0
Atacameño 0,019 0,017 0
Chango 0,025 0,105 0,059 0
Pehuenche 0,214 0,425 0,328 0,163 0
Mapuche 0,236 0,468 0,365 0,197 0 0
Huilliche 0,126 0,302 0,215 0,042 0,050 0,076 0
Alacalufe 0,384 0,592 0,544 0,356 0,122 0,149 0,145 0
Yagane 0,271 0,531 0,424 0,236 0 0 0,095 0,118 0
Ona 0,262 0,537 0,419 0,254 0,016 0 0,143 0,318 0 0
Tehuelche 0,179 0,395 0,298 0,092 0,011 0,031 0 0,099 0,043 0,104 0

Tabla 4 Distancias Fst entre poblaciones actuales mixtas sudamericanas y originaras de Chile y Argentina. Fst distances between contemporary mixed South American and native Chilean and Argentinian populations . 

Quechua Aimara Atacameño Chango Pehuenche Mapuche Huilliche Yagan Alacalufe Ona Tehuelche
Amazonia 0,034 0,256 0,122 0,061 0,115 0,129 0,091 0,146 0,358 0,115 0,116
Brasil Noreste 0,095 0,304 0,179 0,096 0,175 0,206 0,092 0,216 0,311 0,235 0,128
Bolivia Tierras Altas 0,026 0,015 0 0,053 0,335 0,367 0,217 0,416 0,499 0,415 0,293
Bolivia Tierras Bajas 0,038 0,222 0,110 0,075 0,136 0,148 0,108 0,167 0,326 0,141 0,136
Perú 0 0,084 0,025 0,013 0,193 0,216 0,105 0,250 0,361 0,244 0,155
Argentina Norte 0,089 0,293 0,175 0,120 0,124 0,136 0,114 0,146 0,291 0,129 0,132
Argentina Sur 0,085 0,303 0,182 0,054 0,036 0,053 0,018 0,064 0,203 0,073 0,023
Norte Grande 0,005 0,097 0,035 0 0,179 0,206 0,088 0,248 0,429 0,239 0,138
Norte Chico 0,048 0,300 0,150 0,109 0,156 0,168 0,151 0,192 0,478 0,134 0,181
Zona Central 0,045 0,215 0,118 0,033 0,077 0,091 0,047 0,1125 0,264 0,101 0,065
Zona Sur 0,097 0,296 0,189 0,064 0,031 0,039 0,034 0,0543 0,215 0,049 0,032

El pueblo quechua presenta distancias bajas con Brasil (noroeste), Bolivia (tierras altas y tierras bajas), Perú, Chile (Norte Grande, Norte Chico y Zona Central). A su vez, los aimaras presentan distancias bajas con Bolivia (tierras altas) y los atacameños con Bolivia (tierras altas), Perú y Chile (Norte Grande). Los changos a su vez son indistinguibles de Chile (Norte Grande) y pehuenches, mapuches y huilliches presentan distancias pequeñas con Chile (Zona Sur) y Argentina (Sur) y también distancias moderadas con Brasil (noreste), Bolivia (tierras bajas), Argentina (norte) y Chile (Zona central). Los tehuelches presentan distancias bajas con Argentina (Sur) y Chile (Zona sur) y moderadas con Chile (Zona central). Los yaganes exhiben distancias moderadas con Argentina (sur) y Chile (Zona sur). Los alacalufes aparecen genéticamente distanciados de las regiones geográficas y de los pueblos originarios incluidos en el análisis. No sería de extrañar que el pequeño tamaño al que fue reducido este grupo por los invasores europeos produjo variaciones aleatorias de las frecuencias de haplogrupos que constituyen la base de los valores de distancia genética Fst.

Discusión

Información recientemente publicada acerca de la distribución de marcadores del cromosoma Y en la población chilena (Moraga et al. 2016; Toscanini et al. 2015) validan nuestra reconstrucción de las diferencias de género que caracteriza a los componentes ancestrales americano y europeo para el Norte Grande y Norte Chico. Posiblemente el tamaño pequeño de las muestras, el diferente lugar de muestreo y el flujo génico europeo que afectó a las zonas meridionales en forma diferencial, pueden explicar las discrepancias menores observables para las Zonas sur y austral.

Si bien la comparación entre las RN de Chile entre sí y con las poblaciones mixtas sudamericanas se basa en haplogrupos pan-americanos, vale decir haplogrupos que no se encuentran en poblaciones europeas o africanas, la reconstrucción de rutas migratorias que ocurrieron hace miles de años, debería ser consideradas tentativa, ya que el desplazamiento de individuos y poblaciones, así como los cambios demográficos y la disrupción social creada por la invasión europea, podrían haber afectado la distribución de las poblaciones originarias a lo largo del país. No obstante, llama la atención el hecho que el haplogrupo B, que es característico de los grupos quechuas, aimara y atacameño disminuya gradualmente desde el Norte Grande a la Zona sur y los haplogrupos C y D, frecuentes en los grupos mapuche, pehuenche, huilliche, alacalufe y yagán aumenten proporcionalmente, indicando que la presencia física de estos pueblos dejó una impronta genética claramente reconocible (Tabla 1). Hace excepción la distancia genética relativamente alta de aimaras y mapuches con Chile (Norte Chico) que contrasta con el valor bajo que presentan quechuas. Este último grupo originario, a su vez presenta valores de Fst bajos con Brasil (noreste), Bolivia (tierras bajas) y Argentina (norte) sugiriendo la ocurrencia de migración desde Brasil (noreste) a través del Gran Chaco y Bolivia (tierras bajas) y Argentina (norte) hacia Chile (Norte Chico) (Tabla 4). Recordemos que Mostny (1954) ya planteó la posible relación de los mapuches con la cultura Molle. Desde el punto de vista genético no sería sorprendente que el origen de esta cultura podría estar vinculada con desarrollos culturales que ocurrieron en la región de los valles Calchaquíes. El hecho que los quechuas se vinculan sustancialmente más a la Amazonia (Fst = 0,034) que los aimaras (Fst = 0,256), plantea la hipótesis que estos últimos descienden de los primeros. Información genética publicada (Reich et al. 2012; Wang et al. 2007; Wang et al. 2008) apoya esta hipótesis. La cercanía de los huilliches a Argentina sur indicaría un posible origen transandino de esta etnia. Esta hipótesis también es avalada por la proximidad genética de huilliches con la etnia tehuelche. Resulta interesante señalar que huilliches conocidos como “huiliches serranos” y luego como “manzaneros” en Argentina habitaron la región de Neuquén desde el río Agrio al río Limay. Luego, supuestamente ocuparon territorios ubicados al sur de la Provincia de Mendoza, desplazando a los pehuenches. Sin embargo, también se sostiene que estos huilliches surgieron parcial o totalmente de un proceso de miscegenación con grupos tehuelches o que, al igual que los pehuenches, habrían sido originalmente huárpidos relacionados con los puelches algarroberos de Cuyo (Benchis 2000). El origen de los huilliches es un buen ejemplo de cómo se puede complicar el estudio de los orígenes de los pueblos originarios al no borrar mentalmente la existencia de los límites nacionales actuales. Lo más probable es que todo el “complejo araucano”, en su sentido más amplio, ocupara una vasta región a ambos lados de la Cordillera de los Andes y se movilizara dentro de esa región, cruzando por cierto la cordillera de acuerdo con las conveniencias del momento y experimentando paralelamente un proceso gradual de microdiferenciación genética y por cierto también, cultural.

Sorprende descubrir que los datos del último censo oficial de Chile (Censo 2002) no concuerdan con los resultados obtenidos en este trabajo. Por ejemplo, en la antigua región de Tarapacá (actualmente Región de Arica y Parinacota y Región de Tarapacá) del total de habitantes, 48.665 se declararon pertenecientes a un grupo étnico, de los cuales 83% aproximadamente declararon ser aimara, 11% mapuche, 2% atacameño y 2% quechua. No obstante y en concordancia con los hechos históricos, la distancia genética de la población del Norte Grande a los grupos quechua es muy pequeña (Fst = 0,005) y al grupo aimara casi 20 veces superior (Fst = 0,097). Nos encontramos entonces en el norte frente a una discordancia entre la cultura, incluyendo el idioma, con la cual se identifican muchas personas y su real patrimonio genético. No obstante, en la Zona sur se observa predominio de personas que se declaran pertenecientes al grupo étnico mapuche. Por ejemplo en la región de la Araucanía, de acuerdo al Censo 2002, del total de habitantes,

204.195 se declararon pertenecientes a algún grupo étnico y 203.221 (99,5%) se declararon mapuches, probablemente incluyendo a los representes de los pueblos pehuenche y huilliche.

Conclusiones

Actualmente conviven en la región andina meridional de América del Sur numerosos grupos de pueblos originarios moderadamente divergentes desde el punto de vista genético. En el norte quechuas, aimaras, atacameños y en la costa descendientes de changos. En el sur pehuenches, mapuches, huilliches y tehuelches y en el extremo sur alacalufes, yaganes y onas. El análisis de varianza molecular (AMOVA) indica que los tres grupos (norte, sur y extremo sur) difieren en su composición genética en un 27% y los pueblos incluidos dentro de cada grupo en un 4%, alcanzando el total de genes compartidos un 69%. Estos resultados son estadísticamente significativos.

Cabe señalar que además los resultados obtenidos concuerdan bien con hipótesis previas sobre el origen de los grupos étnicos chilenos. Llamamos especialmente la atención sobre el hecho que varias hipótesis sobre el origen de los grupos mapuches incluyen un posible aporte genético amazónico.

Analizando más detenidamente ésta posibilidad, estamos ahora en condiciones de proponer que efectivamente existió flujo génico de la Amazonia a la población mapuche a través de al menos dos vías migratorias, una utilizando los territorios que actualmente ocupan Perú y Bolivia (tierras altas) y la otra en forma independientemente a través de Bolivia (tierras bajas) y Argentina (norte). Desde luego, siendo un hecho que la importancia de la Amazonia en el desarrollo de complejidad cultural andina ha sido previamente destacada por numerosos investigadores desde principios del siglo pasado (Lathrap 1970; Rivera y Rothhammer 1991; Rothhammer y Silva 1992; Rothhammer et al. 2009; Sauer 1952; Tello 1929; von Hagen [citado por Zerries 1985]; Zerries 1985) nuestra propuesta no constituye una novedad. Sin embargo resulta interesante destacar que entre los grupos amazónicos que aún viven en la Alta Amazonia (Pozzi-Escot 1998) y que de acuerdo con nuestros resultados comparten un conjunto significativo de genes con los quechuas, se encuentran los caribes y arahuacos. Grupos como estos, de acuerdo a Lathrap (1970), se podrían haber movilizado a la Alta Amazonia utilizando como vía de tránsito el sistema fluvial amazónico en busca de nuevo fondo aluvial para la práctica de agricultura de roza. Los desplazamientos poblacionales mencionados, de acuerdo al autor de la hipótesis, probablemente ocurrieron durante el Formativo, cerca de 5.000 a.p., coincidiendo con la llamada transición demográfica neolítica (TDN) gatillada posiblemente por profundos cambios climáticos (Bocquet-Appel 2011). Resulta interesante agregar que importantes investigaciones recientes han destacado el hallazgo de marcadas similitudes genéticas entre los grupos originarios maya y quechua (Reich et al. 2012; Wang et al. 2007; Wang et al. 2008), de modo que los grupos caribes y arahuacos de la Alta Amazonia podrían constituir eslabones microevolutivos intermedios entre mayas y quechuas.

En este trabajo hemos dado respaldo y/o en parte reformulado hipótesis previamente planteadas con base en información arqueológica recurriendo a evidencia genética. Los resultados obtenidos utilizando ADNmt, refuerzan la importancia de la aplicación de diseños metodológicos multidisciplinarios, que si bien frecuentemente son de ejecución más compleja, pueden entregan resultados más concluyentes.

Agradecimientos

Agradecemos el aporte desinteresado de varios revisores que contribuyeron significativamente a mejorar este manuscrito. Investigación financiada por el proyecto Fondecyt 1150031.

Referencias Citadas

Alves-Silva, J., M. Da Silva-Santos, P.E.M. Guimaraes, A.C.S. Ferreira, H.J. Bandelt, S.D.J. Pena y V. Ferreira-Prado 2000. The ancestry of Brazilian mtDNA lineages. American Journal of Human Genetics 67:444-461. [ Links ]

Anderson, S., A.T. Bankier, B.G. Barrell, M.H.L. Bruijn, A.R. Coulson, J. Drouin, I.C. Eperon, D.P. Nierlich, B.A. Roe, F. Sanger, P.H. Schreier, A.J. Smith, R. Staden e I.G. Young 1981. Sequence and organization of the human mitochondrial genome. Nature 290:457-465. [ Links ]

Benchis, M. 2000. Piezas de Etnohistoria del Sur Sudamericano. Consejo Superior de Investigaciones Científicas, Madrid. [ Links ]

Bisso-Machado, R., M.C. Bortolini y F.M. Salzano 2012. Uniparental genetic markers in South Amerindians. Genetics and Molecular Biology 35:365-387. [ Links ]

Bocquet-Appel, J.P. 2011. When the world’s population took off: he springboard of the Neolithic Demographic Transition. Science 333:560-561. [ Links ]

Cabana, G.S., C.M. Lewis Jr., R.Y. Tito, R.A. Covey, A.M. Caceres, A.F.D.L. Cruz, D. Durand, G. Housman, B.I. Hulsey, G.C. Iannacone, P.W. López, R. Martínez, A. Medina, O.O. Dávila, K.P. Pinto, S.I. Santillán, P.R. Dominguez, M. Rubel, H.F. Smith, V.R. Massa, B. Lizárraga y A.C. Stone 2014. Population genetic structure of traditional populations in the Peruvian Central Andes and implications for South American population history, Human Biology 86:147-165. [ Links ]

Catelli, M.L., V. Álvarez-Iglesias, A. Gómez-Carballa, A. Mosquera-Miguel, C. Romanini, A. Borosky, J. Amigo, A. Carracedo, C. Vullo y A. Salas 2011. The impact of modern migration on present-day multi-ethnic Argentina as recode don the mitochondrial DNA genome. BioMed Central Genetics 12:77. [ Links ]

Corporación de Fomento de la Producción (CORFO) (1950-1962). Geografía Económica de Chile. 3 vols. Editorial Universitaria, Santiago. [ Links ]

De la Fuente, C., J. Galimany, B.M. Kemp, K. Judd, O. Reyes y M. Moraga 2015. Ancient marine hunter-gatherers from Patagonia and Tierra del Fuego: Diversity and differentiation using uniparentally inherited genetic markers. American Journal of Physical Anthropology 158:719-729. [ Links ]

Dillehay, T.D. y F. Rothhammer 2013. Quest for the origins and implications for social rights of the Mapuche in the southern cone of South America. Latin American Antiquity 24:149-163. [ Links ]

Excoffier, L. y H.E.L. Lischer 2010. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources 10:564-567. [ Links ]

Fuentes, M., I. Pulgar, C. Gallo, M.C. Bortolini, S. Canizales- Quinteros, G. Bedoya, R. González-José, A. Ruiz-Linares y F. Rothhammer 2014. Geografía génica de Chile. Distribución regional de los aportes genéticos americanos, europeos y africanos. Revista Médica de Chile 142:281-289. [ Links ]

García-Bour, J., A. Pérez-Pérez, S. Álvarez, E. Fernández, A.M. López-Parra, E. Arrollo-Pardo y D. Turbón 2004. Early Population differentiation in extinct aborigines from Tierra del Fuego-Patagonia: Ancient mtDNA sequences andY-chromosome DTR characterization. American Journal of Physical Anthropology 123:361-370. [ Links ]

Guevara, T. 1929. Historia de Chile. Chile Prehispánico. Tomo I, Universidad de Chile, Santiago. [ Links ]

Lahiri, D.K. y J.I. Nurnberger 1991. A Rapid non-enzymatic method for preparation of HMW DNA from blood for RFLP studies. Nucleic Acid Research 19 (19):5444. [ Links ]

Lalueza, C. 1995. Recuperación de DNA Mitochondrial y Caracterización de Variabilidad en Poblaciones Antiguas, PhD Tesis, Universidad de Barcelona, Barcelona. [ Links ]

Latcham, R. 1928. La Prehistoria Chilena. Soc. Imp. y Lit. Universo. Santiago. [ Links ]

Lathrap, D.W. 1970. The Upper Amazon. Thames & Hudson Ltd., Southampton. [ Links ]

Menghin, O. 1962. Estudios de Prehistoria Araucana. Centro Argentino de Estudios Prehistóricos, Buenos Aires. [ Links ]

Merriwether, D.A., F. Rothhammer y R.E. Ferrel 1995. Distribution of the four founding lineage haplotypes in Native Americans suggests a single wave of migration for the New World. American Journal of Physical Anthropology 98: 411-430. [ Links ]

Moraga, M., P. Pezo y M. de Sant Pierre 2016. El genoma de herencia uniparental en el estudio de las poblaciones fundadoras. En El ADN de los Chilenos y sus Orígenes Genéticos, editado por S. Berríos del Solar, pp. 63-90. Editorial Universitaria, Santiago . [ Links ]

Moraga, M ., P. Rocco, J.F. Miquel, F. Nervi, E. Llop, R. Chakraborty, F. Rothhammer y P. Carvallo 2000. Mitochondrial DNA polymosphisms in Chilean Aboriginal populations: Implications for the peopling of the Southern cone of the continent. American Journal of Physical Anthropology 113:19-29. [ Links ]

Mostny, G. 1954. Prehistoria de Chile. Editorial Universitaria, Santiago . [ Links ]

Nass, M. y S. Nass 1963. Intramitochondrial fibers with DNA characteristics I. fixation and electron staining reactions. The Journal of Cell Biology 19:593-611. [ Links ]

Porcel, R.E. 2007. La Araucanización de Nuestra Pampa. Los Tehuelches y Pehuenches. Los Mapuches Invasores. Porcel, R.E., Buenos Aires. [ Links ]

Possi-Escot, I. 1998. El Multilingüismo en el Perú. Centro de Estudios Regionales y Andinos “Bartolomé de Las Casas”, Cusco. [ Links ]

Reich, D., N. Patterson, D. Campbell, A. Tandon, S. Mazieres, N. Ray, M.V. Parra, W. Rojas, C. Dique, N. Mesa, L.F. García, Triana, S. Blair, A. Maestre, J.C. Dib, C.M. Bravi, G. Bailliet, D. Corach, T. Hunemeier, M.C. Bortolini, F.M. Salzano, M.L. Petzl-Erler, V. Acuña-Alonzo, C. Aguilar-Salinas y S. Canizales-Quinteros 2012. A reconstructing Native American population History. Nature 488:370-374. [ Links ]

Rivera, M. y F. Rothhammer 1991. The Chinchorro people of Northern Chile 5000 BC-500 BC. A review of their culture and relationships. International Journal of Anthropology 3:243-255. [ Links ]

Rocco, P., C. Morales, M. Moraga, J.F. Miquel, F. Nervi, E. Llop, P. Carvallo, F. Rothhammer 2002. Composición genética de la población chilena. Distribución de polimorfismos de DNA mitocondrial en grupos originarios y en la población mixta de Santiago. Revista Médica de Chile 130 (2):125-131. [ Links ]

Rothhammer, F., C. Santoro, E. Poulin, M. Moraga y V. Standen 2009. Archeological and mtDNA evidence for tropical lowland migrations during the late archaic/formative in northern Chile. Revista Chilena de Historia Natural 82:543-552. [ Links ]

Rothhammer, F. y C. Silva 1992. Gene Geography of South America: Testing models of population displacements based on archaeological evidence. American Journal of Physical Anthropology 89:441-446. [ Links ]

Rothhammer, F., C. Silva, J.A. Cocilovo y S. Quevedo 1986. Una hipótesis provisional sobre el poblamiento de Chile basada en el análisis multivariado de medidas craneométricas. Chungara 16-17:295-306. [ Links ]

Sauer, C.O. 1952. Agricultural Origins and Dispersals. The American Geographical Society, New York. [ Links ]

Taboada-Echalar, P., V. Álvarez-Iglesias, T. Heinz, L. Vidal-Bralo, A. Gómez-Carballa, L. Catelli, J. Pardo-Seco, A. Pastoriza, A. Carracedo, A. Torrez-Balanza, O. Rocabado, C. Vullo y A. Salas 2013. The genetic legacy of the pre-colonial period in contemporary Bolivians. Plos One 8:1-14. [ Links ]

Tello, J.C. 1929. Antiguo Perú. I Época. Empresa Editora Excelsior, Lima. [ Links ]

Toscanini, U., F. Moreno, J.A. Pantoja-Astudillo, E.A. Morales, P. Bustos y A. Salas 2015. A reference frecuency database of 15 autosomal STRs in Chile. Forensic Science International Genetics 19:35-36. [ Links ]

Wang, S., C.M. Lewis, M. Jabobsson, S. Ramachandran, N. Ray, G. Bedoya, W. Rojas, M.V. Parra, J. Molina, C. Gallo , G. Mazzotti, G. Poletti, K. Hill, A.M. Hurtado, D. Labuda, W. Klitz, R. Barrantes, M.C. Bortolini, F.M. Salzano, M. Petzl-Erler, L.T. Tsuneto, E. Llop, F. Rothhammer, L. Excoffier, M. Feldman, N. Rosenberg y A. Ruiz-Linares 2007. Genetic variation and population structure in native Americans. Plos Genetics 3 (11): 2049-2067. [ Links ]

Wang, S., N. Ray, W. Rojas, M.V. Parra, G. Bedoya, C. Gallo , Poletti, G. Mazzotti, K. Hill, A.M. Hurtado, B. Camrena, Nicolini, W. Klitz, R. Barrantes, J.A. Molina, N.B. Freimer, M.C. Bortolini, F.M. Salzano, M.L. Petzl-Erler, L.T. Tsuneto, J.E. Dipierri, E.L. Alfaro, G. Bailliet, N.O. Bianchi, E. Llop, F. Rothhammer , L. Ecoffier y A. Ruiz-Linares 2008. Geographic patterns of genome admixture in Latin American mestizos. Plos Genetics 4:1-9. [ Links ]

Zerries O. 1985. Morteros para Parica, Tabletas para Aspirar y Bancos Zoomorfos. Indiana 10 (2):421-441. [ Links ]

Received: November 2016; Accepted: July 2017

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons