SciELO - Scientific Electronic Library Online

 
vol.60 número1-2Acrocomia aculeata (Palmae), hábitat silvestre de Rhodnius robustus en el Estado Trujillo, VenezuelaDisminución en la prevalencia de anticuerpos contra Toxoplasma gondii en adultos del valle central de Costa Rica índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Parasitología latinoamericana

versión On-line ISSN 0717-7712

Parasitol. latinoam. v.60 n.1-2 Santiago jun. 2005

http://dx.doi.org/10.4067/S0717-77122005000100003 

 

Parasitol Latinoam 60: 25 - 31, 2005 FLAP

ARTÍCULO ORIGINAL

 

Dientamoeba fragilis: Técnicas moleculares para dilucidar su modo de transmisión

Dientamoeba fragilis: MOLECULAR BIOLOGY TECHNIQUES FOR THE ELUCIDATION OF ITS MODE OF TRANSMISSION

 

CLAUDIA I. MENGHI*, RICARDO MAKIYA*, CLAUDIA L. GATTA* y OSCAR C. MÉNDEZ*

  * Área Parasitología, Departamento de Bioquímica Clínica, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires, 1113. Buenos Aires, Argentina.


Dientamoeba fragilis is a human intestinal protozoon. Its worldwide prevalence ranges mostly between 1.4% and 19%. Very little is known to date about its virulence, pathogenicity, and mode of transmission; and no cyst stage has been identified yet. A wide spectrum of gastrointestinal symptoms has been described in a great number of infected patients: diarrhoea, flatulence, colic, and weight loss, amongst others. The simultaneous association between infections with D. fragilis and those caused by Enterobius vermicularis lead Burrows and Swerdlow in 1956 to speculate about the probable role of pinworm eggs in transmission. This work is the first attempt to detect the presence of D. fragilis DNA on the outer shell of E. vermicularis eggs, by means of a DNase assay and posterior identity verification by means of a restriction digest analysis of PCR products with HinfI, in co-infections with both parasites. Enterobiosis is extremely prevalent in human beings worldwide. In paediatric patients with direct evidence of pinworm infection, the search for D. fragilis should be enhanced.

Key words: Dientamoeba fragilis DNA; transmission; Enterobius vermicularis; DNase assay; Restriction digest analysis; co-infections.

RESUMEN

Dientamoeba fragilis es un protozoario intestinal humano. Su prevalencia mundial oscila aproximadamente entre 1,4% y 19%. Muy poco se sabe actualmente sobre su virulencia, patogenicidad, modo de transmisión; y no se ha identificado aún un estadio quístico. Un amplio espectro de síntomas gastrointestinales ha sido descrito en un gran número de pacientes infectados: diarrea, flatulencia, cólicos, y pérdida de peso, entre otros. La asociación simultánea entre las infecciones causadas por D. fragilis y Enterobius vermicularis llevó a Burrows y Swerdlow en 1956 a especular sobre el probable rol de los huevos de E. vermicularis en la transmisión. Este trabajo es la primera tentativa para detectar la presencia del DNA de D. fragilis en los huevos de E. vermicularis. Para ello se realizó un ensayo con DNasa y posterior verificación de la identidad mediante un análisis de restricción enzimática de los productos de PCR con HinfI, en infecciones simultáneas con ambos parásitos. A nivel mundial, la enterobiosis es muy frecuente. En los pacientes pediátricos con evidencia directa de infección por E. vermicularis, deberá intensificarse la búsqueda de D. fragilis en materia fecal.


INTRODUCCIÓN

Inicialmente a Dientamoeba fragilis, se la consideró una ameba y actualmente está clasificada dentro de los flagelados1,2. Los trofozoitos miden aproximadamente entre 5 y 15 µ, con un rango promedio de 9 a 12 µ. En las tinciones permanentes la mayor parte de los organismos presentan 2 núcleos, a pesar de que casi del 30% al 40% son mononucleados. La cromatina nuclear se halla fragmentada en grupos de 3 a 8 gránulos; en algunos casos se observa un número mayor. En el núcleo no se observa cromatina periférica. En los cultivos, como fue informado por otros autores3, D. fragilis puede confundirse con la forma ameboide de Blastocystis hominis, parásito éste último mucho más frecuente y pleomórfico. En un extendido de materia fecal en fresco, los trofozoitos de D. fragilis presentan un citoplasma vacuolado que puede contener principalmente bacterias o detritos. Algunos investigadores aprovecharon la capacidad que tienen los trofozoitos de D. fragilis para ingerir gránulos de almidón de arroz en los cultivos y distinguirlos de B. hominis 3; éste no los ingiere.

D. fragilis fue descrita por primera vez en 19181. Muy poco se conoce actualmente sobre su virulencia, patogenicidad, y modo de transmisión; hasta el momento no se han descrito formas quísticas2,4. Un amplio espectro de síntomas gastrointestinales, desde diarrea, flatulencia, hasta cólicos y pérdida de peso, han sido señalados en pacientes infectados5 -9. Su distribución es cosmopolita y su prevalencia varía ampliamente (1,4% - 19%). La infección con D. fragilis tiene una tendencia a ser más frecuente en poblaciones pediátricas. Los valores de incidencia son mayores en pacientes menores de 20 años7. Los datos sobre la prevalencia en nuestra población de Buenos Aires son escasos; se halló un valor de 16,10% en un grupo constituido en su mayor parte por pacientes pediátricos (datos no publicados).

La asociación simultánea entre las infecciones por D. fragilis y Enterobius vermicularis , llevó a especular sobre el probable rol de los huevos de este verme en la transmisión5, 10. Ni su modo de transmisión ni su ciclo de vida, han sido dilucidados aún; estudios epidemiológicos muestran una estrecha relación entre las infecciones por D. fragilis y la enterobiosis7,10. Se presume que la transmisión de una persona a otra ocurre cuando se ingieren huevos de E. vermicularis que albergan trofozoitos, ya sea dentro o sobre la superficie externa. En consecuencia, si esta hipótesis se confirmara, la infección por los dos parásitos estaría asociada y justificaría los resultados hallados.

Otro autor11, apoyó esta hipótesis y al mismo tiempo, postuló como hipótesis que los trofozoitos de D. fragilis se transmiten dentro de los huevos de E. vermicularis como parásitos de las larvas (parásitos del parásito); y por ende los trofozoitos no se transportarían sobre la superficie externa de los huevos. En las investigaciones concer-nientes a las infecciones simultáneas entre ambos parásitos5,10, se describieron secciones de apéndices infectados con gusanos adultos de E. vermicularis. Los autores observaron algunos organismos pequeños, ameboides, uninucleados sobre la superficie externa de diversos huevos. Estos organismos se asemejaban bastante a los trofozoidos de D. fragilis aislados del lumen de apéndices fijados en formol, y no se hallaron en los huevos de E. vermicularis de pacientes no infectados simultáneamente con D. fragilis10.

El objeto del presente trabajo será determinar la presencia o no del DNA de D. fragilis sobre la superficie externa o dentro del huevo de E. vermicularis, en infecciones simultáneas con ambos parásitos. Para este estudio, se recurrirá a métodos de biología molecular para amplificar selectivamente una secuencia de DNA de D. fragilis con la ayuda de "primers" obtenidos del grupo de las Trichomonas spp. y de "primers" para D. fragilis. De esta forma se aprovechará la relación filogenética existente entre D. fragilis y otros miembros del grupo Parabasalia, una asociación fundamentada en varios trabajos12,-16.

MATERIAL Y MÉTODOS

Muestras: Se recogieron en agua hembras grávidas de E. vermicularis provenientes de pacientes infectados simultáneamente con ambos parásitos, D. fragilis y E. vermicularis. Los vermes de pacientes infectados sólo con E. vermicularis se utilizaron como controles negativos.

Las hembras grávidas se colocaron en un medio RPMI (Roswell Park Memorial Institute) 1.640 (Sigma Aldrich), y se mantuvieron a 4°C hasta su posterior maceración para liberar los huevos de sus úteros. Se consideró a un paciente infectado simultáneamente por ambos parásitos cuando se confirmó la presencia de trofozoitos de D. fragilis mediante la técnica de coloración tricrómica, y cuando se observaron huevos de E. vermicularis en los escobillados anales. Una muestra control de DNA de D. fragilis (cedida gentilmente por el Dr. C. Graham Clark de The London School of Tropical Medicine and Hygiene, Londres, Inglaterra), y hembras grávidas de E. vermicularis conservadas en agua de pacientes no infectados por D. fragilis fueron utilizadas como controles positivo y negativo, respec-tivamente.

Ensayo de la DNasa: El "pellet" con la hembra macerada se contaminó con 10 µl de amplicones provenientes del gen híbrido humano BCR-ABL (Cromosoma Philadelphia) para ser utilizado como control de la DNasa. Luego el "pellet" se dividió en dos fracciones iguales (a) y (b) de 60 µl. La fracción (a) fue tratada con DNasa, no así la fracción (b). Se ajustó el buffer de la DNasa, y 1 µl de la enzima se agregó a la fracción (a); se incubó durante 30 min a 37°C. Luego se inactivó la enzima a 94°C y se agregaron 10 µl de ethylene glycol-bis-tetraacetic acid (EGTA) para completar la inactivación.

Ruptura de las membranas de los huevos de E. vermicularis17: Se agregaron 8 µl de NaOH 1 M y 2,4 µl de 2-mercaptoetanol (2- ME) 1 M a ambas fracciones (a) y (b). Luego ambas muestras fueron incubadas durante 30 min a 65° C en el ciclador (Perkin Elmer 2.400). Para neutralizar se agregaron 8 µl de ClH 1 M y las muestras se centrifugaron durante 3 min a 10.000 r.p.m. Finalmente se agregó el "carrier" (10 µg de DNA humano normal).

Extracción del DNA: Se utilizó para la extracción el método de fenol cloroformo. Se suspendieron aproximadamente 200 µl de cada "pellet" en 200 µl de Tris-ClH 100 mM pH 7,5 con cetyl-trimetyl-ammonium bromide (CTAB) al 2%, ClNa 1,4 M, 2-ME al 0,2% y EDTA 20 mM. Luego de una agitación con "vórtex" se agregaron 400 µl de fenol saturado en agua con Tris-ClH 100 mM pH 7,5. Se agitaron nuevamente y se agregaron 100 µl de cloroformo: alcohol isoamílico (24:1). Luego las muestras se agitaron con "vórtex" durante 2 min y se centrifugaron a 13.000 r.p.m durante 5 min. Se recogieron cuidadosamente los sobrenadantes y se volcaron en sendos tubos Eppendorf. Luego se agregó un volumen igual de alcohol isopropílico frío. Finalmente se agitaron con el "vórtex" y se conservaron a -20° C durante una hora. El DNA se concentró por centrifugación a 13.000 r.p.m durante 10 min, se lavó con etanol 70 % y el "pellet" de DNA se resuspendió en 50 µl de Tris-ClH 100 mM pH 7,5.

PCR: Se desarrolló una "nested" PCR con dos sets de "primers" y una temperatura de hibridación de 55° C para D. fragilis; otra reacción de PCR se realizó con un set de "primers" y una temperatura de hibridación de 57° C para E. vermicularis.

"Nested" PCR para la amplificación del DNA de D. fragilis: Se realizaron dos rondas de amplificación con dos sets de "primers". La primera ronda se realizó con los "primers" TRD5 (GATACTTGGTTGATCCTGCCAAGG) y TRD3 (GATCCAACGGCAGGTTCACCTACC) deducidos de la secuencia del rRNA de tipo 16S de D. fragilis16 GenBank (N° de acceso U37461). El tamaño esperado del producto final fue de 1676 pb. La segunda ronda de amplificación se llevó a cabo con los "primers" internos DF3 (GGTTGGATACTCCTACTCTCGC) y DF5 (TTGTAACCTAGCAGAGGGCCAG) donados por el Dr. C. Graham Clark. Una cepa de DNA de D. fragilis se utilizó como control positivo. Se obtuvo un amplicón de 414 pb. La mezcla de reacción en ambas rondas de PCR consistió de Tris-HCl 10 mM pH 9,0, KCl 50 mM, Triton X-100 al 0,1%, MgCl2 2,5 mM, 200 mM de cada uno de los 4 dNTPs, 0,8 mM de cada "primer" y 0,025 U/ml de Taq polimerasa (Promega) y 1 ml de solución de DNA o 1 ml del producto de la primera ronda de amplificación en un volumen total de 25 ml. Se realizó un total de 40 ciclos de 94°C (1 min), 55°C (1 min) y 72°C (1 min 30 seg) en cada ronda seguidos de una extensión final a 72°C durante 5 min. Los productos de amplificación se visualizaron bajo luz ultravioleta luego de realizar la electroforesis en un gel de agarosa al 1,8% en buffer tris-borato-EDTA (TBE) 0.5 x, con bromuro de etidio.

PCR para la amplificación del DNA de E. vermicularis: Se llevó a cabo una ronda de amplificación con un set de "primers": EV1 (CGACTCCAAGGTCTACTCAG) y EV2 (CGCTGAACTTAAGCATATCA); GenBank (N° de acceso AF182295). El producto final fue de 247 pb. La mezcla de reacción consistió de Tris-HCl 10 µM pH 9,0, KCl 50 µM, Triton X-100 al 0,1%, MgCl2 2,5 µM, 200 µM de cada uno de los 4 dNTPs, 1 µM de cada "primer" y 0,025 U/ml de Taq polimerasa (Promega) y 1ml de la solución de DNA. Se realizó un total de 40 ciclos de 94°C (1 min), 57°C (1 min) y 72°C (1 min 30 seg) seguidos de una extensión final de 72°C durante 5 min. Los productos de amplificación se visualizaron bajo luz ultravioleta luego de realizar la electroforesis en un gel de agarosa al 1,8% en buffer TBE 0.5 x, con bromuro de etidio.

Análisis de los productos de PCR con la enzima de restricción Hindi: La identidad del DNA de D. fragilis se confirmó mediante el uso de la enzima de restricción HinfI (Promega). Se realizó una reacción de "semi-nested" PCR con los "primers" TRD5 y DF3 anteriormente mencionados. Otra reacción de "semi-nested" PCR se realizó con los "primers" DF5 and TRD3; y una "nested" PCR se desarrolló con los "primers" DF3 y DF5. La mezcla de reacción en las tres reacciones de PCR consistió de: Tris-HCl 10 µM pH 9,0, KCl 50 µM, Triton X-100 al 0,1%, MgCl2 2,5 µM, 200 µM de cada uno de los 4 dNTPs, 0,8 µM de cada "primer" y 0,025 U/ml de Taq polimerasa (Promega) y 1ml de la solución de DNA. Se realizó un total de 40 ciclos a 94°C (1 min), 55°C (1 min) y 72°C (1min 30 seg) seguidos de una extensión final de 72°C durante 5 min. Los productos de amplificación se digirieron con HinfI (0,5 U/ml) en el buffer provisto por el fabricante (Promega buffer B). Luego se incubó durante 16 horas a 37°C para permitir la digestión. Los fragmentos de restricción obtenidos luego de la digestión con HinfI, se visualizaron bajo luz ultravioleta luego de realizar la electroforesis en gel de agarosa al 1,8% en buffer TBE 0,5x con bromuro de etidio.

RESULTADOS

Para evaluar si el DNA de D. fragilis se hallaba sobre la membrana externa del huevo de E. vermicularis o dentro del mismo, se desarrolló el siguiente ensayo. Se obtuvieron de cuatro pacientes infectados simultáneamente con D. fragilis, cuatro hembras grávidas de E. vermicularis. Los huevos se liberaron de sus úteros y una porción de ellos fue tratada con DNasa, seguido de la inactivación de la enzima y posterior ruptura de las membranas para liberar los ácidos nucleicos. La porción remanente de los huevos no fue sometida a la acción de la enzima y sólo sobrellevó la ruptura de sus membranas. Los resultados de dos de los cuatro pacientes se muestran en la Figura 1 a-b. No se detectó ningún producto de amplificación al agregar la DNasa seguido de la inactivación posterior de la enzima y ruptura de la membrana de los huevos de E. vermicularis. Esto confirmó la ausencia del DNA de D. fragilis dentro de los huevos de E. vermicularis. Tampoco se observaron productos de amplificación (como era de esperar) con el control de la DNasa (BCR-ABL). (Figura 1 a-b, calle 2).


Figura 1 a-b. Electroforesis en gel de agarosa de los productos de amplificación de PCR. Presencia de DNA de D. fragilis sobre la membrana externa de los huevos de E. vermicularis. Calles M: marcador de tamaño molecular (100 pb); 1: control de la DNasa (sin pretratamiento con DNasa); 2: control de la DNasa (pretratamiento con la DNasa); 3: producto de amplificación del DNA de D. fragilis sobre la membrana externa de los huevos de E. vermicularis (sin pretratamiento con DNasa); 4: ausencia del producto de amplificación del DNA de D. fragilis dentro de los huevos de E. vermicularis (pretratamiento con DNasa, inactivación de la enzima y posterior ruptura de las membranas de los huevos de E. vermicularis); 5: producto de amplificación del DNA de E. vermicularis (247 pb) (sin pretratamiento con DNasa); 6: producto de amplificación del DNA de E. vermicularis (247 pb) (pretratamiento con DNasa, inactivación de la enzima y posterior ruptura de las membranas de los huevos de E. vermicularis). a* y b*: dos pacientes infectados simultáneamente con ambos parásitos.

Un producto de amplificación de 414 pb correspondiente a D. fragilis fue detectado en el caso en que la DNasa no fue agregada y luego de la ruptura de la membrana de los huevos. (Figura 1 a-b, calle 3). Este hallazgo confirmó la presencia de DNA de D. fragilis sobre la superficie externa de los huevos de E. vermicularis. Un producto de amplificación se obtuvo con el control de la DNasa (Figura 1 a-b, calle 1). En el caso de pacientes infectados solamente con E. vermicularis no se detectaron productos de amplificación de D. fragilis en el gel (Figura 2).


Figura 2. Electroforesis en gel de agarosa de los productos de amplificación de PCR Ausencia del DNA de D. fragilis en los huevos de E. vermicularis de pacientes infectados solamente con el helminto. Calles M: marcador de tamaño molecular (100 pb); 1: control de la DNasa (sin pretratamiento con DNasa); 2: control de la DNasa (pretratamiento con la DNasa); 3: ausencia del producto de amplificación del DNA de D. fragilis sobre la membrana externa de los huevos de E. vermicularis (sin pretratamiento con DNasa); 4: ausencia del producto de amplificación del DNA de D. fragilis dentro de los huevos de E. vermicularis (pretratamiento con DNasa, inactivación de la enzima y posterior ruptura de las membranas de los huevos de E. vermicularis); 5: producto de amplificación del DNA de E. vermicularis (247 pb) (sin pretratamiento con DNasa); 6: producto de amplificación del DNA de E. vermicularis (247 pb) (pretratamiento con DNasa, inactivación de la enzima y posterior ruptura de las membranas de los huevos de E. vermicularis).

Para verificar la identidad del DNA detectado sobre la membrana externa de los huevos de E. vermicularis como perteneciente a D. fragilis, se diseñó un análisis con la enzima de restricción HinfI. En la Figura 3 se observan los productos de PCR luego del tratamiento con la enzima de restricción de uno de los cuatro pacientes (calles 1, 2 y 3) y los productos de PCR de la cepa control de D. fragilis, obtenidos luego del tratamiento con la misma enzima (calles 4, 5 y 6). (Figura 3). Una "semi-nested" PCR con los "primers" DF5 y TRD3 generó un producto de PCR final que contenía cinco sitios de restricción para HinfI. Cinco fragmentos de restricción (597 pb, 209 pb, 127 pb, 87 pb y 76 pb) se muestran en la Figura 3, calle 2. Otra "semi-nested" PCR se desarrolló con la combinación de los "primers" TRD5 y DF3. El producto de PCR obtenido no contenía ningún sitio de restricción para HinfI (Figura 3, calle 1). Tampoco se observó ningún fragmento, luego del tratamiento con la enzima del producto de PCR obtenido con los "primers" DF5 y DF3, como puede observarse en la Figura 3, calle 3.


Figura 3. "Semi-nested" PCR. Análisis con la enzima de restricción HinfI de los productos de amplificación del DNA de D. fragilis. Calles 1, 2 y 3: muestra del paciente Calles 4, 5 y 6: cepa control de D. fragilis Calles M: marcador de tamaño molecular (100 pb); 1: digestión con HInfI del producto de PCR obtenido entre los "primers" TRD5 y DF3; 2: digestión con HinfI del producto de PCR obtenido entre los "primers" DF5 y TRD3; 3: digestión con HinfI del producto de PCR obtenido entre los "primers" DF5 y DF3; 4: digestión con HinfI del producto de PCR obtenido entre los "primers" TRD5 y DF3; 5: digestión con HinfI del producto de PCR obtenido entre los "primers" DF5 y TRD3; 6: digestión con HinfI del producto de PCR obtenido entre los "primers" DF5 y DF3.

En la Figura 3, calle 5 se muestran los mismos cinco fragmentos que se observan en la calle 2, y corresponden a la cepa control de DNA de D. fragilis.

Los resultados obtenidos en las calles 4 y 6 son idéntidos a los de las calles 1 y 3.

DISCUSIÓN

Para tratar de dilucidar el enigma de la transmisión de D. fragilis se diseñó un ensayo donde se utilizó la DNasa para detectar la presencia del DNA de D. fragilis sobre la superficie externa del huevo de E. vermicularis, o dentro del mismo. En este estudio cuatro hembras grávidas de E. vermicularis de diferentes pacientes infectados simultáneamente con ambos parásitos, se recogieron en un medio RPMI 1640. Luego se las sometió a la ruptura de sus úteros para la liberación de los huevos. Se halló evidencia, por primera vez, de la presencia del DNA de D. fragilis sobre la membrana externa de los huevos de E. vermicularis y no dentro de los mismos, como fue demostrado con el ensayo de la DNasa. Por lo tanto se confirmó la hipótesis de Burrows y Swerdlow propuesta en 1956, donde hallaron estructuras que se asemejaban a trofozoitos de D. fragilis sobre los huevos de E. vermicularis presentes en los apéndices de pacientes infectados simultáneamente con ambos parásitos. Estas estructuras no se hallaron en los huevos de E. vermicularis localizados en apéndices de pacientes no infectados simultáneamente con D. fragilis. Resultados similares se obtuvieron en nuestro estudio en pacientes infectados solamente con E. vermicularis donde no se obtuvo ningún producto de amplificación del DNA de D. fragilis ni sobre la membrana externa, ni dentro de los huevos de E. vermicularis.

El concepto de que pudiese existir conta-minación con materia fecal se descarta, pues a las hembras adultas del helminto, se las lavó sucesivamente con agua y se las preservó en el medio RPMI 1.640. Los huevos se obtuvieron directamente de los úteros, libres de cualquier contaminación fecal. Los patrones electro-foréticos de los fragmentos obtenidos luego de la utilización de la enzima HinfI a partir de las muestras de los pacientes, resultaron idénticos a los obtenidos con la cepa control de D. fragilis. Este hallazgo permitió asumir que la identidad del DNA detectado sobre la membrana externa de los huevos de E. vermicularis confirmaría que pertenece a D. fragilis. A pesar de que el análisis con enzimas de restricción constituye un acercamiento eficiente que brinda resultados satisfactorios, y es relativamente simple y rápido, sería conveniente realizar un análisis de secuenciación para confirmar la identidad del DNA de D. fragilis.

La enterobiosis está distribuida ampliamente a nivel mundial; por esa causa, en los pacientes pediátricos con síntomas de infección por E. vermicularis, se deberá investigar meticulosamente la presencia de D. fragilis en materia fecal.

Este trabajo representa un avance; estudios posteriores serían necesarios para dilucidar en forma completa el modo de transmisión de D. fragilis.

 

REFERENCIAS

1.- Jepps M W, Dobell C. Dientamoeba fragilis n.g., a new intestinal amoeba from man. Parasitology 1918; 10: 352-67.         [ Links ]

2.- Johnson E H, Windsor J J, Clark C G. Emerging from obscurity: biological, clinical, and diagnostic aspects of Dientamoeba fragilis. Clin Microbiol Rev 2004; 17: 553-70.         [ Links ]

3.- Sawangjaroen N, Luke R, Prociv P. Diagnosis by faecal culture of Dientamoeba fragilis infections in Australian patients with diarrhoea. Trans R Soc Trop Med Hyg 1993; 87: 163-5.         [ Links ]

4.- Wenrich D H. Studies on Dientamoeba fragilis (Protozoa). I. Observations with special reference to nuclear structure. J Parasitol 1936; 22: 76-83.         [ Links ]

5.- Burrows R B, Swerdlow M A, Frost J K, et al. Pathology of Dientamoeba fragilis infections of the appendix. Am J Trop Med 1954; 3: 1033-9.         [ Links ]

6.- Steinitz H, Talis B, Stein B. Entamoeba histolytica and Dientamoeba fragilis and the syndrome of chronic recurrent intestinal amoebiasis in Israel. Digestion 1970; 3: 146-53.         [ Links ]

7.- Yang J, Scholten T H. Dientamoeba fragilis: A review with notes on its epidemiology, pathogenicity, mode of transmission, and diagnosis. Am J Trop Med Hyg 1977; 26: 16-22.         [ Links ]

8.- Preiss U, Ockert G, Broemme S, et al. On the clinical importance of Dientamoeba fragilis infections in childhood. J Hyg Epidemiol Microbiol Immunol 1991; 35: 27-34.         [ Links ]

9.- Grendon J H, Digiacomo R F, Frost F J. Descriptive features of Dientamoeba fragilis infections. J Trop Med Hyg 1995; 98: 309-15.         [ Links ]

10.- Burrows R B, Swerdlow M A. Enterobius vermicularis as a probable vector of Dientamoeba fragilis. Am J Trop Med 1956; 5: 258-65.         [ Links ]

11.- Chang S L. Parasitization of the parasite. JAMA 1973; 223: 1510.         [ Links ]

12.- Viscogliosi E, Philippe H, Baroin A, et al. Phylogeny of Trichomonads based on partial sequences of large subunit rRNA and on cladistic analysis of morphological data. J Eukaryot Microbiol 1993; 40: 411-21.         [ Links ]

13.- Gunderson J, Hinkle G, Leipe D et al. Phylogeny of Trichomonads inferred from small-subunit rRNA sequences. J Eukaryot Microbiol 1995; 42: 411-5.         [ Links ]

14.- Silberman J D, Clark C G, Sogin M L. Dientamoeba fragilis shares a recent common evolutionary history with the trichomonads. Mol Biochem Parasitol 1996; 76: 311-4.         [ Links ]

15.- Delgado - Viscogliosi P, Viscogliosi E, Gerbod D, et al. Molecular phylogeny of parabasalids based on small subunit rRNA sequences, with emphasis on the Trichomonadidae subfamily. J Eukaryot Microbiol 2000; 47: 70-5.         [ Links ]

16.- Johnson J A, Clark C G. Cryptic genetic diversity in Dientamoeba fragilis. J Clin Microbiol 2000; 38: 4653-4.         [ Links ]

17.- Hamburger J, Yu-Xin, X, Ramzy R M, et al. Development and laboratory evaluation of a polymerase chain reaction for monitoring Schistosoma mansoni infestation of water. Am J Trop Med Hyg 1998; 59: 468-73.         [ Links ]

Agradecimientos: Al Dr. Graham Clark del Departamento de Enfermedades Infecciosas y Tropicales de The London School of Hygiene and Tropical Medicine, Londres, Inglaterra, por la donación de una muestra patrón de DNA de D. fragilis y los "primers" DF5 y DF3.

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons