SciELO - Scientific Electronic Library Online

 
vol.61 número3-4Enfermedad de Chagas en Costa Rica: Estudio comparativo en dos épocas diferentesHelminths of the Spotted Nothura, Nothura maculosa (Temminck, 1815) (Aves, Tinamidae) in South America índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


Parasitología latinoamericana

versión On-line ISSN 0717-7712

Parasitol. latinoam. v.61 n.3-4 Santiago dic. 2006

http://dx.doi.org/10.4067/S0717-77122006000200008 

 

Parasitol Latinoam 61: 146 - 151, 2006 FLAP

ARTÍCULO ORIGINAL

 

Detección molecular de Dientamoeba fragilis en heces: eliminación de los inhibidores de la DNA polimerasa

MOLECULAR DETECTION OF Dientamoeba fragilis IN FAECES: REMOVAL OF DNA- POLYMERASE INHIBITORS

 

CLAUDIA IRENE MENGHI*, CLAUDIA LILIANA GATTA*, R. MAKIYA* y OSCAR CESAR MÉNDEZ*

* Área Parasitología, Departamento de Bioquímica Clínica, Hospital de Nicas, Facultad de Farmacia y Bioquímica, Universidad de Buenos Aires.
* Claudia Irene Menghi Teodoro García 2350 7° A Capital Federal. E-mail: cmenghi@fibertel.com.ar


We report an assay for the DNA purification of Dientamoeba fragilis trophozoites by means of a commercially available spin-columns technique from frozen non-formalin-fixed human stool specimens containing high concentrations of DNA -polymerase inhibitors. This method was compared with a phenol/chloroform technique; followed both of them by an amplification assay and an electrophoresis of amplicons. A nested PCR assay was developed to allow the detection of D. fragilis DNA. The DNA extraction from D. fragilis trophozoites using a fast spin-columns procedure, yielded high-quality DNA, free of impurities and enzyme inhibitors; in contrast with the phenol/chloroform technique, where inhibition was observed when the amplification products were analyzed by agarose-gel electrophoresis. Besides, the addition of SAF (sodium acetate-acetic acid-formalin) to faecal specimens, that affects the integrity of DNA and, consequently, hinders its further amplification, was confirmed.

Key words: Dientamoeba fragilis, PCR, inhibitors, DNA purification.

RESUMEN

Se realizó un estudio de purificación del DNA de los trofozoitos de Dientamoeba fragilis a partir de muestras fecales humanas congeladas, no fijadas en formol, y con elevadas concentraciones de inhibidores de la DNA polimerasa. Para tal fin, se utilizaron columnas ("spin-columns") disponibles en el comercio. Esta metodología se comparó con una técnica tradicional de purificación con fenol/cloroformo. Ambos métodos fueron seguidos de la amplificación del DNA de D. fragilis por una "nested" PCR y posterior electroforesis en un gel de agarosa de los amplicones obtenidos. La extracción del DNA a partir de trofozoitos de D. fragilis - mediante el procedimiento de las columnas - produjo DNA de elevada calidad, libre de impurezas e inhibidores de la polimerasa. Por el contrario, con la técnica de fenol/cloroformo se observó la inhibición de la enzima, cuando se analizaron los productos de amplificación. Además, se confirmó que el agregado de SAF (solución de acetato de sodio - ácido acético - formol) a las muestras fecales afecta la integridad del DNA y como consecuencia impide su posterior amplificación.


INTRODUCCIÓN

Dientamoeba fragilis, fue considerado inicialmente una ameba debido a su desplazamiento por medio de pseudópodos. Estudios posteriores lo ubicaron taxonómicamente dentro de los flagelados1-3. Su distribución es amplia, con tasas de prevalencia de 1,4% a 19%4. Este parásito presenta complicaciones para su identificación, y la mayor dificultad radica en su breve supervivencia en el medio ambiente, así como la mala conservación de los trofozoitos en los medios de cultivo por un tiempo prolongado5,6. Por lo tanto, para su identificación, la materia fecal debe ser examinada inmediatamente, o conservada en un fijador adecuado. Hasta la fecha

no se conocen las formas quísticas, que en cambio están presentes en la mayoría de los protozoarios. Muy poco se sabe sobre su modo de transmisión, epidemiología y patogenicidad. Sin embargo, su elevada asociación con infecciones por Enterobius vermicularis, sugirió su transmisión a través de los huevos de este nematode7-10. Dicha asociación tiene importancia clínica porque la presencia de uno de los parásitos hace imprescindible la búsqueda del otro, dado que el tratamiento de E. vermicularis es diferente del de D. fragilis, y ambos parásitos afectan a niños que se reinfectan periódicamente con el gusano alfiler. La identificación de D. fragilis por PCR tiene importancia epidemiológica, porque permite estudiar su transmisión en diversas situaciones sanitarias. En la actualidad diversos autores consideran a D. fragilis como agente causal de síntomas gastrointestinales9,11; pero, recientemente, a partir de la década del 90, se comenzaron a publicar trabajos acerca de la determinación molecular de D. fragilis. Es de notar, que el análisis de la secuencia del rRNA de tipo 16S, establece que D. fragilis pertenece al grupo de las trichomonas2. En investigaciones sobre la variación genética de este parásito se ha llegado a la conclusión de que este microorganismo representa como mínimo dos entidades genéticas significativamente diferentes12. La identificación de ciertas secuencias del parásito en materia fecal no había sido resuelta previamente, dado que los autores citados trabajaron en medios de cultivo.

El objeto de este estudio es valorar la importancia de la eliminación de los diversos inhibidores de la DNA polimerasa presentes en las muestras fecales que dificultan el diagnóstico molecular de D. fragilis.

MATERIAL Y MÉTODOS

Muestras de materia fecal frescas o fijadas en SAF (solución de acetato de sodio - ácido acético - formol)13, fueron recibidas en el Área de Parasitología del Departamento de Bioquímica Clínica, Facultad de Farmacia y Bioquímica y Hospital de Clínicas de la Universidad de Buenos Aires (UBA). Estas muestras pertenecían a pacientes infectados o no por D. fragilis. La presencia de este protozoario se sospechó cuando se realizó la observación microscópica de preparaciones húmedas en muestras conservadas en SAF. En esas imágenes microscópicas no se observaron núcleos y el citoplasma presentaba numerosas inclusiones. Esas presunciones se confirmaron cuando se realizaron las coloraciones tricrómicas permanentes de las muestras fijadas en alcohol polivinílico (PVA).

Las muestras frescas se congelaron a -20° C durante 5 días, hasta el momento de la extracción del DNA. En una de las muestras se observó sólo la presencia de Blastocystis hominis, y fue utilizada como control debido a que este último presenta una secuencia similar de bases muy cercana a la de D. fragilis dentro de la región complementaria a TRD5.

Los huevos de E. vermicularis se obtuvieron de escobillados anales, recogidos en agua o en formol al 5%. Cuando se recolectaron hembras adultas de E. vermicularis en la zona perianal, éstas fueron maceradas para obtener los huevos a partir de sus úteros. Las hembras se colocaron en un tubo Eppendorf y se maceraron con una varilla hasta la ruptura del ejemplar en partes más pequeñas. Una vez obtenidos los huevos, éstos se suspendieron en agua, se concentraron por medio de varias centrifugaciones y los "pellets" obtenidos se congelaron a -20° C hasta el momento de su estudio.

Se utilizaron 2 métodos diferentes para obtener el DNA de D. fragilis a partir de las heces. Uno de ellos, consistió de una extracción con fenol/cloroformo. Aproximadamente, 200 µl de heces se suspendieron en 200 µl de Tris-HCl 100 mM pH 7,5 que contenía bromuro de cetil-trimetil-amonio al 2% (CTAB), NaCl 1,4 M, 2-mercaptoetanol al 0,2% y EDTA 20 mM. Luego de una agitación vigorosa en un "vórtex", se agregaron a la muestra 400 µl de fenol saturado con agua cuyo pH se equilibró con 100 mM de Tris-HCl pH 7,5. Luego se agitó la mezcla en el "vórtex" y se agregaron 100 µl de cloroformo: alcohol isoamílico (24:1). Posteriormente, la mezcla se agitó durante 2 minutos, y luego, se centrifugó a 13.000 rpm durante 5 minutos. Se recuperó cuidadosamente el sobrenadante, se lo colocó en un tubo de Eppendorf nuevo, y se agregó un volumen igual de alcohol isopropílico frío. Luego, la muestra se agitó en el "vórtex" y se conservó a -20° C durante 1 hora. El DNA se concentró por centrifugación a 13.000 rpm durante 10 minutos, se lavó con etanol al 70 % y se resuspendió en 50 µl de Tris-HCl 100 mM pH 7,5.

El segundo método de extracción de DNA de D. fragilis se realizó con el mini kit Qiagen de "spin-columns" para DNA en materia fecal (QIAamp DNA stool Mini Kit, Cat. N° 51504), y se trabajó de acuerdo con las especificaciones del fabricante, sin realizar modificaciones. La solución final de 200 µl de DNA se precipitó con alcohol isopropílico frío, y el "pellet" se resuspendió en 20 µl de Tris-HCl 100 mM pH 7,5. Se realizaron dos rondas de amplificaciones con dos "sets" anidados de "primers". La primera ronda se realizó con los "primers" TRD5 (GATACTTGGTTGATCCTGCCAAGG) y TRD3 (GATCCAACGGCAGGTTCACCTACC) deducidos de la secuencia del rRNA de tipo 16-S de D. fragilis12). El tamaño estimado del producto final fue de 1.676 pares de bases (pb). La segunda ronda de amplificaciones se realizó con los "primers" internos DF3 (GGTTGGATACTCCTACTCTCGC) y DF5 (TTGTAACCTAGCAGAGGGCCAG).

Los "primers" DF3 y DF5 y el DNA de D. fragilis usado como control positivo fueron gentilmente cedidos por el Dr. Graham Clark (The London School of Hygiene & Tropical Medicine, Londres, Inglaterra). La mezcla de la reacción en ambas rondas de PCR contenía Tris-HCl 10 mM pH 9,0, KCl 50 mM, Tritón X-100 al 0,1%, MgCl2 2,5 mM, 200 µM de cada uno de los cuatro dNTPs, 0,8 µM de cada "primer", 0,025 U/µl de Taq polimerasa (Promega) y 1 µl de solución de DNA o 1 µl del producto de la primera ronda de amplificación en un volumen total de 25 µl.

Se realizó un total de 40 ciclos a 94° C (1 min), 55° C (1 min), y 72° C (1 min 30 seg) para cada ronda, seguidos de una extensión final, a 72° C, durante 5 minutos.

Los productos de amplificación se visualizaron con luz ultravioleta, en un gel de agarosa en buffer tris borato EDTA (TBE) 0.5x, con bromuro de etidio.

Para evaluar la interferencia del SAF en el proceso de amplificación se diseñó otra experiencia. Para ello, se estudiaron muestras fecales frescas congeladas y muestras fecales fijadas en SAF congeladas. Ambos tipos de muestra correspondían al mismo paciente infectado con D. fragilis. Se purificó el DNA a partir de aproximadamente 100 mg de cada muestra por medio del método de "spin - columns". Cien miligramos de materia fecal fresca congelada del mismo paciente se mezcló con 3 gotas de SAF, y se dejó en reposo durante 5 minutos antes de la purificación del DNA. A otros 100 mg de la misma muestra, se les agregó 10 ml de SAF, 5 días previos a la purificación del DNA; otra porción de 100 mg de la misma muestra se conservó congelada sin el agregado de SAF. El DNA obtenido de estas tres muestras se amplificó por medio de la reacción de la polimerasa y se analizó por medio de electroforesis en un gel de agarosa.

RESULTADOS

Se procesaron cinco muestras de materia fecal que contenían trofozoítos de D. fragilis con el fin de realizar una "nested PCR". El "pattern" electroforético de una de las muestras se observa en la Figura 1. En este caso, el DNA de D. fragilis se purificó por medio de la técnica de columnas. En esta figura se observa un fragmento de DNA de 414 pb, proveniente de una de las muestras de materia fecal congelada, concentrada, sin formol. Esta muestra, concentrada, había sido previamente centrifugada durante 5 minutos (Figura 1, calle 1). El mismo fragmento de DNA de 414 pb de la misma muestra, sin concentrar, sin formol, se observa en la Figura 1, calle 2. En la Figura 1, calle 3 se observa el mismo fragmento de DNA correspondiente a la cepa patrón de D. fragilis. No se observa ninguna banda cuando el DNA fue extraído de muestras recogidas en soluciones conservadoras (Figura 1, calles 4 y 5). La calle 5 corresponde a un escobillado anal en formol al 5% de un paciente infectado simultáneamente con ambos parásitos. El motivo de la incorporación de esta muestra en el estudio estuvo sugerido por la hipótesis de que los trofozoitos de D. fragilis podrían ser transportados por medio de los huevos de E. vermicularis7-10.


 

Figura 1. Electroforesis en gel de agarosa de los productos de amplificación de PCR a partir de trofozoitos de D. fragilis. M: Marcador de tamaño (M): 100 pb. Calles: 1, muestra fecal concentrada, congelada, no fijada en formol; 2, muestra fecal no concentrada, congelada, no fijada en formol; 3, control positivo (muestra patrón de DNA de D. fragilis); 4, muestra fecal recogida en SAF; 5, escobillado anal en formol al 5%; 6, muestra fecal negativa congelada (control negativo); 7, muestra fecal congelada no fijada en formol con Blastocystis hominis, sin la presencia de trofozoitos de D. fragilis.

A pesar de que B. hominis tiene una secuencia similar de bases, muy cercana con la de D. fragilis, dentro de la región complementaria a TRD5, no se detectó ninguna banda de amplificación (Figura 1, calle 7).

Los "patterns" electroforéticos de otras tres muestras de materia fecal congeladas, no fijadas en formol se observan en la Figura 2. En las tres muestras, el DNA se purificó usando el procedimiento de las columnas donde hubo amplificación de todos los eludidos (Figura 2, calles 1- 3); con las mismas muestras congeladas, no fijadas en formol, el DNA se sometió a la técnica de purificación con fenol / cloroformo (Figura 2, calles 4-6). En la calle 4 no se observa amplificación alguna, y sólo dos reacciones de amplificación son escasamente visibles en presencia de los eludidos preparados con la técnica de purificación con fenol / cloroformo (Figura 2, calles 5 y 6).


 

Figura 2. Análisis en gel de agarosa de los productos de amplificación de PCR a partir de trofozoitos de D. fragilis de muestras fecales congeladas, no fijadas en formol. Comparación entre la técnica de purificación de DNA mediante el procedimiento de las columnas y una técnica de extracción con fenol / cloroformo. M): 100 pb. Calles 1-3: purificación con el procedimiento de las columnas.
Calles 4-6: purificación con la técnica de fenol / cloroformo sin el uso de las columnas.

En la Figura 3 se muestran los productos de amplificación luego del agregado del SAF a muestras fecales congeladas que contenían trofozoitos de D. fragilis.


 

Figura 3. Análisis en gel de agarosa de los productos de amplificación de PCR de dos muestras fecales fijadas en SAF, de un paciente infectado por D. fragilis. Calle M: Marcador de tamaño (M): 100 pb. Calles 1: materia fecal congelada, sin SAF. Calles 2: idem calle 1 con el agregado de 3 gotas de SAF, 5 minutos previos a la extracción del DNA. Calle 3: idem calle 1 con el agregado de 10 ml de SAF 5 días previos a la purificación del DNA.

DISCUSIÓN

El diagnóstico de D. fragilis debe realizarse a partir de heces recién emitidas debido a que los trofozoitos se degeneran o se destruyen a las pocas horas de haber sido eliminados. Como se mencionó anteriormente, los trofozoitos presentan dificultades para su mantenimiento en cultivo durante un período prolongado.

Los métodos tradicionales para el diagnóstico de D. fragilis utilizan la tinción permanente. La microscopía es aún ampliamente utilizada, a pesar de los inconvenientes que presenta el diagnóstico de este parásito especialmente en preparaciones húmedas; y aun en el examen microscópico de las coloraciones permanentes cuando es realizado por microscopistas poco entrenados.

El DNA de parásitos es fácilmente extraído cuando se parte de organismos cultivados y muestras de biopsias, pero la extracción del DNA en materia fecal representa un problema para el desarrollo de la técnica de PCR debido a la presencia de inhibidores en cantidades significativas.

Los protocolos de amplificación de PCR presentan dos obstáculos principales cuando se utiliza materia fecal humana. Uno, la conservación de la muestra -la mayoría de las veces se recolecta en fijadores que contienen formol-; el otro, es la remoción de los inhibidores de la PCR, que depende del método utilizado para la extracción del DNA14,15. Cuando las muestras fecales se conservan en formol, es muy difícil la obtención de amplicones debido a la naturaleza de este fijador que perfunde al trofozoito y reacciona con el DNA. Lo mismo ocurre con el SAF. En nuestra experiencia, en lo que respecta a la interferencia del SAF en el proceso de amplificación del DNA, nuestros resultados coinciden con lo publicado por otros autores16. Por lo tanto, para la amplificación eficiente del DNA de D. fragilis, a partir de trofozoitos en materia fecal, es necesario utilizar muestras frescas congeladas sin formol.

La extracción del DNA de los trofozoitos de D. fragilis con la metodología de columnas a partir de muestras fecales congeladas, no fijadas en formol, permite la obtención de DNA puro, libre de inhibidores. En contraste, la extracción del DNA de D. fragilis por medio de la técnica con fenol/cloroformo, no elimina completamente los inhibidores presentes en la materia fecal. Además, la presencia de concentraciones variables de hemoglobina, sales biliares, pectinas, fenoles, y carbohidratos, puede obstaculizar la reproducibilidad de las técnicas de PCR14,15. Este trabajo coincide con lo publicado por otros autores en que la metodología de columnas es lo suficientemente efectiva para la purificación del DNA de D. fragilis a partir de materia fecal16.

Los métodos moleculares constituyen una herramienta útil y acompañan a las técnicas de coloración y microscopía en el diagnóstico de los protozoarios. La eliminación de los inhibidores de la PCR representa un aporte significativo para el diagnóstico e investigación de los parásitos en heces.

 

REFERENCIAS

1.- LEVINE N D, CORLISS J O, COX FEG, et al. A newly revised classification of the protozoa. J Protozool 1980; 27: 37-58.         [ Links ]

2.- SILBERMAN J D, CLARK C G, SOGIN M L. Dientamoeba fragilis shares a recent common evolutionary history with the trichomonads. Mol Biochem Parasitol 1996; 76: 311-4.         [ Links ]

3.- WINDSOR J J, JOHNSON E H. Dientamoeba fragilis: the unflagellated human flagellate. A review. Br J Biomed Sci 1999; 56: 293-306.         [ Links ]

4.- SAWANGJAROEN N, LUKE R, PROCIV P. Diagnosis by faecal culture of Dientamoeba fragilis infections in Australian patients with diarrhoea. Trans R Soc Trop Med Hyg 1993; 87: 163-5.         [ Links ]

5.- DWYER D M. Improved method for cultivation of Dientamoeba fragilis. J Parasitol 1969; 55: 1088-9.         [ Links ]

6.- STEINITZ H, TALIS B, STEIN B. Entamoeba histolytica and Dientamoeba fragilis and the syndrome of chronic recurrent intestinal amoebiasis in Israel. Digestion 1970; 3: 146-53.         [ Links ]

7.- BURROWS R B, SWERDLOW M A. Enterobius vermicularis as a probable vector of Dientamoeba fragilis. Am J Trop Med 1956; 5: 258-65.         [ Links ]

8.- CHANG S L. Parasitization of the parasite. JAMA 1973; 223: 1510.         [ Links ]

9.- YANG J, SCHOLTEN T H. Dientamoeba fragilis: a review with notes on its epidemiology, pathogenicity, mode of transmission and diagnosis. Am J Trop Med Hyg 1977; 26: 16-22.         [ Links ]

10.- MENGHI C, MAKIYA R, GATTA C, et al. Dientamoeba fragilis: técnicas moleculares para dilucidar su modo de transmisión. Parasitol Latinoam 2005; 60: 25-31.         [ Links ]

11.- PREISS U, OCKERT G, BROEMME S, et al. On the clinical importance of Dientamoeba fragilis infections in childhood. J Hyg Epidemiol Microbiol Immunol 1991; 35: 27-34.         [ Links ]

12.- JOHNSON J A, CLARK C G. Cryptic genetic diversity in Dientamoeba fragilis. J Clin Microbiol 2000; 38: 4653-4.         [ Links ]

13.- JUNOD L. Technique coprologique novele essentie-llement destinee a la concentration des trophozoites d´amibes. Bull Soc Pathol Exot 1972; 65: 390-8.         [ Links ]

14.- DA SILVA A J, BORNAY-LLINARES F J, MOURA I N S, et al. Fast and reliable extraction of protozoan parasite DNA from fecal specimens. Mol Diagn 1999; 4: 57-64.         [ Links ]

15.- ORLANDI P A, LAMPEL K A. Extraction-free, filter-based template preparation for rapid and sensitive PCR detection of pathogenic parasitic protozoa. J Clin Microbiol 2000; 38: 2271-7.         [ Links ]

16.- STARK D, BEEBE N, MARRIOTT D, et al. Detection of Dientamoeba fragilis in fresh stool specimens using PCR. Int J Parasitol 2005; 35: 57-62.         [ Links ]

 

Agradecimientos: Agradecemos al Dr. C. Graham Clark de The London School of Hygiene & Tropical Medicine (Londres, Inglaterra), por cedernos gentilmente una muestra patrón de DNA de D. fragilis y los "primers" DF5 y DF3, y a la Prof. Dra. Regina W. de Wikinski por su colaboración en la revisión de este manuscrito.

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons