SciELO - Scientific Electronic Library Online

 
vol.22 número2ALTERACIONES MORFOLÓGICAS Y MORFOMÉTRICAS INDUCIDAS POR ÁCIDO VALPROICO EN CARTÍLAGO DE MECKEL, MUSCULATURA LINGUAL Y GLÁNDULA SUBMANDIBULAR DE FETOS DE RATASESTUDIO MORFOMÉTRICO DE LA REGIÓN CRÁNEOFACIAL DE LA CABRA ENANA DEL OESTE AFRICANO EN NIGERIA índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

Compartir


International Journal of Morphology

versión On-line ISSN 0717-9502

Int. J. Morphol. v.22 n.2 Temuco  2004

http://dx.doi.org/10.4067/S0717-95022004000200007 

 

Int. J. Morphol., 22(2):139-144, 2004.

 

ASOCIACIÓN ENTRE LA PÉRDIDA DEL CROMOSOMA X EN MUJERES DE EDAD AVANZADA Y EL POLIMORFISMO DE LA APOLIPOPROTEÍNA A-IV:360 GLN/HIS

ASSOCIATION OF CHROMOSOME X LOSS IN ELDERLY WOMEN WITH APOLIPOPROTEIN A-IV:360 POLYMORPHISM

 

*,**Tatiana Flank Ejchel; **Lara Quirino Araújo; **Luiz Roberto Ramos; **Maisa Seabra Cendoroglo; *Rommel Rodriguez Burbano & *Marilia de Arruda Cardoso Smith

* Disciplina de Genética, Departamento de Morfología, Universidade Federal de São Paulo/Escola Paulista de Medicina; São Paulo, SP, Brasil.
**Disciplina de Geriatría, Departamento de Clínica Médica, Universidade Federal de São Paulo/Escola Paulista de Medicina; São Paulo, SP, Brasil.
Financiado por la Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) y Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

Dirección para correspondencia


RESUMEN: La pérdida del cromosoma X en mujeres, asociada a la edad avanzada, es un fenómeno ya reconocido hace décadas. Los factores genéticos que llevan a esta pérdida o a la no-disyunción cromosómica, son poco conocidos. Polimorfismos de apolipoproteínas fueron asociados a la ocurrencia de síndromes cromosómicos como las trisomías del 18 y 21 y fue sugerida su participación en la segregación cromosómica. Polimorfismos de la apolipoproteína AIV:360 fueron asociados a molestias cardiovasculares en la población brasileña.Veinticuatro mujeres entre 72 a 87 años, fueron seleccionadas para estudiar la presencia o ausencia del alelo 2 (HIS) y analizar la pérdida del cromosoma X. El análisis citogenético fue realizado en núcleos interfásicos de cultivos de linfocitos por técnica de hibridación in situ con sonda fluorescente centromérica del cromosoma X. El análisis genotípico fue realizado a partir de ADN extraído de la sangre, amplificado por PCR y digerido por la enzima de restricción Fnu4HI. Se observó una proporción significantemente mayor de células con la pérdida del cromosoma X, en mujeres con alelo 2 (HIS). Estos resultados indican la participación del gen de la ApoA-IV en la no-disyunción cromosómica. Los mecanismos de su actuación pueden estar relacionados a daños oxidativos producto de alteraciones en la microcirculación e inducción de muerte celular. La comprensión de este mecanismo todavía necesita de mayor investigación.

PALABRAS CLAVE: 1. Polimorfismo de la APOA-IV: 360 GLN/HIS; 2. Pérdida del cromosoma X; 3. Citogenética.


SUMMARY: Chromosome X loss associated with advancing age in women is well stablished in cytogenetics. However, genetic factors involved in this chromosome loss or no disjunction are poorly understood. Apolipoproteins have been associated with chromosome syndromes, such as Trisomy 21 and 18 and their participation in chromosome segregation have been suggested. Apolipoprotein A-IV:360 polymorphism has been associated with cardiovascular diseases, in our population. Twenty four old women, aged 72 to 87 years old selected according to the presence or absence of allele 2 (HIS) were investigated in relation to chromosome X loss. Cytogenetic analysis was performed in interphase lymphocyte nuclei by means of FISH ( Fluorescence In Situ Hibridization) using X centromeric DNA probe. DNA was isolated from blood cells amplified by PCR and digested with Fnu4HI. A higher significant proportion of cells with X chromosome loss was observed in elderly women with allele 2 (HIS) .These results indicate the participation of apolipoprotein A-IV:360 polymorphism in chromosome segregation. The involved mechanisms could be related to oxidative damage related to microcirculation abnormalities and cell death. The biological role of apolipoprotein A-IV on chromosome segregation needs to be further investigated.

KEY WORDS: 1. A.IV.360 polymorphism; 2. Chromosome X lose; 3. Citogenetics.


 

INTRODUCCIÓN

La pérdida cromosómica relacionada a la vejez está bien establecida en citogenética hace varias décadas y fue inicialmente descrita por Jacobs et al. (1961). Se confirmó, posteriormente, que en mujeres de edad ocurría pérdida preferencial del cromosoma X (Jacobs et al., 1963; Ford & Russel, 1985). Diversos trabajos confirman esta pérdida asociada a la edad avanzada, incluyéndose el de Kormann-Bortolotto et al. (1993), realizado en nuestro laboratorio.

La introducción de técnicas de hibridación in situ con sondas de ADN fluorescentes (FISH) de cromosomas X y de Y en cinco mujeres y cinco hombres reveló la exclusión significativamente elevada de estos cromosomas, en micronúcleos de individuos con más de 70 años (Guttenbach et al., 1994). Estas observaciones fueron confirmadas en núcleos interfásicos de 38 mujeres por Hando et al. (1994), en 12 mujeres por Catalán et al. (2000) y en 90 mujeres y 138 hombres con edades entre 1 semana y 93 años, por Guttenbach et al. (1995).

El análisis citogenético de núcleos interfásicos de mujeres y hombres, por FISH, mostró que en mujeres centenarias la pérdida del cromosoma X ocurría en 22% de las células, en tanto que en las jóvenes, en 1,7%. En los hombres centenarios la pérdida del cromosoma Y ocurría en 10% de las células y en los jóvenes en 1,6% (Bukvic et al., 2001).

Los factores genéticos que llevan a alteraciones en la segregación cromosómica, sorprendentemente son poco conocidos. La pérdida del cromosoma X puede ser el resultado de diversos mecanismos celulares, como alteraciones en el centrómero, en los microtúbulos del huso, en la producción de tubulina y en la microcirculación que puede llevar a daños oxidativos en la célula (Guttenbach et al., 1994, 1995; Geller & Potter, 1999).

Genes de apolipoproteínas fueron destacados como factores genéticos responsables de alteraciones en la segregación cromosómica, en virtud de que determinados polimorfismos se presentan significantemente más prevalentes en progenitores de individuos com síndromes cromosómicos.

En un estudio de madres de 188 individuos con síndrome de Down, se observó en madres jóvenes de individuos con el síndrome que presentaron errores de la meiosis II, la frecuencia del alelo E4 de la apolipoproteína E fue 30% mayor que el encontrado en madres más viejas (p=0.03), sugiriendo que el alelo E4 es un factor de riesgo para la no-disyunción en la meiosis II en madres jóvenes. Los autores sugieren que los portadores de este alelo presentan un elevado nivel de colesterol y, consecuentemente, alteraciones cardiovasculares y aterosclerosis, que por medio de la microvascularización local podría llevar a una deficiencia de oxígeno en el folículo. La ApoE es producida en varios órganos, inclusive en el ovario y la no-disyunción podría ser también explicada por la unión de sus isoformas con las proteínas asociadas al microtúbulo. El papel biológico de la ApoE en la segregación cromosómica todavía precisa ser aclarado (Avramopoulos et al., 1996).

El estudio de Ezquerra et al. (1998) observó aún mayor frecuencia del alelo E4, en madres de individuos con Síndrome de Down resultantes de errores en la meiosis I en lugar de la meiosis II.

El estudio de alelos de la ApoE en 56 individuos con trisomías 13, 18 y 21 mostró una mayor frecuencia del alelo E4 solamente en los individuos con trisomías 13 y 18. Los autores sugieren que el papel de la ApoE en la inducción de aneuploidías, pueda ser por alteraciones en la microcirculación, actividad alelo-específica relacionada a la apoptosis o daño oxidativo (Nagy et al. 2000).

En individuos con el mal de Alzheimer se observó aumento significativo de células trisómicas 21, en individuos con mutaciones en los genes de las pre-senilinas 1 y 2, responsables de la enfermedad, porque permiten el excesivo depósito da proteína beta-amiloide en el cerebro de los afectados, con consecuente muerte neuronal (Geller & Potter). Los autores sugieren también la participación de estos genes en la alteración del proceso de división celular, que tiene como consecuencia la apoptosis de las células neuronales de los afectados. Otras explicaciones como la localización de las pre-senilinas en el núcleo y en la membrana celular y su relación con la proteína p53, fueron sugeridas. La participación de estos genes en la no-disyunción cromosómica fue confirmada en madres de individuos con síndrome de Down que presentaron errores en la meiosis II (Petersen et al., 2000). Estos autores apuntan hacia la localización nuclear de las pre-senilinas, en centrómeros y cinetocoros, estructuras que participan de la regulación y división celulares como responsables de la no-disyunción.

El gen de la apopoliproteína AIV (APO-IV) participa del metabolismo de los lípidos y puede ser la clave para el entendimiento de la susceptibilidad o la resistencia a aterogénesis y longevidad. A pesar del hecho que la función precisa de la apoAIV no es bien conocida, esta proteína participa de la absorción de alimentos ricos en grasas. (Ordovas et al., 1989; Weinberg et al., 1990), del transporte de triacilglicerol (Otha et al., 1985), del transporte reverso de colesterol y de la modulación de la actividad de muchas enzimas (Duverger et al., 1996).

Esta proteína es sintetizada primariamente en los enterocitos del intestino delgado durante la absorción de grasas y es secretado hacia la linfa. En el plasma, la mayor parte de la apoA-IV es encontrada como proteína libre y solamente una pequeña porción se une a los quilomicrones y a las lipoproteínas de alta densidad (HDL) (Weinberg & Spector, 1985).

La secuencia del ADN mostró que la substitución del nucleótido G por T, convirtió glutamina en histidina en la posición 360 de la proteína madura, siendo considerados respectivamente alelo1 (GLN) y alelo 2 (HIS) (Lohse et al., 1990).

Fue sugerido que la ApoAIV podría ejercer un efecto protector contra la aterosclerosis por la inhibición de la peroxidación de lípidos del LDL (Qin et al., 1998).

Con relación a la APOA-IV:360, no existen todavía relatos de investigación de la asociación entre estos polimorfismos, segregación cromosómica y síndromes cromosómicos. El presente trabajo investiga la asociación de los polimorfismos de este gen, en 24 mujeres del Estudio Longitudinal del Envejecimiento Brasileño. Fueron seleccionadas 12 mujeres con ausencia del alelo 2 (HIS) y 12 mujeres con presencia del alelo 2 (HIS).

MATERIAL Y MÉTODO

Selección de individuos. El Estudio Longitudinal del Envejecimiento (Ramos et al., 1998) comenzó en 1991 e involucró a 1667 personas de más de 60 años que vivían en la comunidad de São Paulo, Brasil. Estos voluntarios fueron clínicamente evaluados cada dos años. Ellos fueron comunicados sobre el protocolo de este estudio y otorgaron informaciones sobre sus condiciones médicas previas. Fueron realizados exámenes físicos y clínicos y fueron recolectadas muestras de sangre para procedimientos de laboratorio. El Comité de Ética en Investigación de la UNIFESP aprobó este estudio y todos sus participantes aprueban este trabajo conforme la Declaración de Helsinki.

La evaluación clínica de las 24 mujeres de edad avanzada mostró, igualmente en los dos grupos, individuos sanos y sin alteraciones significativas.

Fueron seleccionadas 12 mujeres con genotipos APOA-IV:360:GLN/GLN o 1-1 (edad media de 78,4+5,11) y 12 con genotipos 360:HIS/HIS y 360:GLN/HIS o 2-2 y 1-2, respectivamente (edad media de 79,3+4,39). La baja frecuencia del alelo 2 (HIS) dificultó la obtención de individuos con alelo 2 para esta muestra.

Cultivo de linfocitos: Los cultivos de linfocitos fueron realizados de acuerdo con la técnica descrita por Moorhead et al. (1960), con modificaciones, en medio de cultivo RPMI, con 10% de suero bovino fetal y fitohemaglutinina.

FISH (hibridación por fluorescencia in situ): La metodología empleada para FISH fue realizada según el protocolo descrito por Pinkel et al. (1986). El análisis del número de señales fluorescentes del cromosoma X, fue realizado con la sonda centromérica LPE 0XG (AquariusTM Probes - Cytocell) en núcleos interfásicos. La Fig. 1 muestra dos núcleos y una metafase con estos marcadores. Los grupos de mujeres con alelo 1 y alelo 2, fueron comparados en relación al número de células con 1 y con 3 o más señales fluorescentes para evaluar la pérdida y ganancia del cromosoma X, por el método del Chi-cuadrado.

Genotipage: El polimorfismo apoA-IV:360Gln/His fue analizado de acuerdo con los procedimientos descritos por Tenkanen (1989) y Hixson & Vernier (1991), con modificaciones. En resumen, una secuencia de 127bp conteniendo el local polimórfico fue amplificado por la reacción en cadena de la polimerasa (PCR) usando los primers HT3 (5´- CACCTGCTCCTGCTACTGCTCC ­ 3´) e HT5 (5´- CCTGAGGGACAAGGTCAACTC ­ 3´). Cada reacción contenía 500ng de ADN y buffer para PCR, MgCl, dNTPs y Taq ADN Polimerasa. La mezcla para la reacción fue calentada, por 5 minutos, a 95C. Posteriormente, el ADN fue amplificado por 30 ciclos (62C por 30 segundos) extendido (72C por 1 minuto) y desnaturalizado (94 por 40 s).

Después de la amplificación, el producto de la PCR fue digerido con la enzima de restricción Fnu4HI, durante 3 h, a 37C. Los productos polimórficos de extensión de los fragmentos de restricción fueron analizados sobre un gel de acrilamida a 12.5%. Después de la electroforesis, los geles fueron sometidos a coloración con plata para la visualización de los fragmentos.

Fig. 1. FISH con la sonda LPE 0XG (Aquarius Probes - Cytocell) en dos núcleos interfásicos y en una metafase, mostrando dos marcaciones para el centrómero del cromosoma X.

RESULTADOS

El grupo de mujeres con el alelo 2 mostró una proporción significantemente mayor de células con pérdida de señal del cromosoma X que el grupo con el alelo 1. Se analizaron por el método del Chi Quadrado (P>0.05) (Tabla I). Usando este mismo método (P>0.05), no fue observada diferencia significativa entre los dos grupos en cuanto al número de células con tres o más señales fluorescentes.

Tabla I. Número de células con una señal fluorescente con sonda centromérica del cromosoma X y total de células con relación a la presencia y ausencia del alelo 2.

 

Ausencia del alelo 2

  Presencia del alelo 2  

Alelo 1 (genotipos)

Edad (años)

Señal 1

Total de células

Alelo 2 (genotipos)

Edad (años)

Señal 1

Total de células

1-1

85

28

342

1-2

74

25

341

1-1

87

33

375

1-2

82

18

237

1-1

86

30

276

1-2

86

23

277

1-1

80

26

239

2-2

77

32

314

1-1

75

32

289

1-2

77

29

252

1-1

77

30

263

1-2

79

27

207

1-1

77

48

400

1-2

75

65

457

1-1

73

28

229

1-2

87

42

276

1-1

72

23

183

1-2

76

55

345

1-1

75

28

217

1-2

77

62

355

1-1

79

35

241

1-2

84

54

308

1-1

75

51

350

1-2

77

39

222

Total

392

3404

 

471

3591

Promedio y SD

78,4±5,11

11,5%

79,3±4,39

13,1%


DISCUSIÓN

Los resultados obtenidos muestran una proporción mayor de células con pérdida del cromosoma X, en las mujeres viejas portadoras del alelo 2, que las portadoras del alelo 1.

Variaciones en los patrones lipídicos y de las lipoproteínas, están altamente relacionadas con enfermedades asociadas a la edad avanzada. Las anormalidades en el metabolismo de los ácidos grasos están relacionadas con la etiología de muchas enfermedades asociadas a la vejez, como patologías cardiovasculares, diabetes y demencia.

Una investigación del Estudio Brasileño Longitudinal del Envejecimiento, realizada en 383 personas de edad, ennuestro laboratorio, mostró la asociación significativa del alelo 2 de la apolipoproteína A-IV con enfermedad cerebro vascular y ataque isquémico transitorio, ( Ejchel et al., 2004).

Los polimorfismos de la apolipoproteína ApoA-IV, parecen determinar diferentes estructuras y funciones de la proteína, (Rader et al., 1993), así la investigación del impacto de cada isoforma en la explicación de cada fenómeno o en la etiología de cada enfermedad, puede ser extremamente relevante.

La asociación de la apolipoproteína E y su variante E4, en madres de individuos con síndrome de Down, como en 56 conceptos con trisomías mostró su participación en la segregación cromosómica.

En la literatura no existen trabajos que den cuenta de variantes de la ApoA-IV en la no-disyunción. Los mecanismos propuestos por los autores que observaron asociación con Apo E y con las pre-senilinas, son mecanismos generales, resultantes de alteraciones en el metabolismo de los lípidos, como las alteraciones microvasculares con daño oxidativo subsiguiente, que también pueden explicar nuestros resultados en cuanto a la asociación del alelo 2 de la ApoA-IV y la pérdida del cromosoma X en mujeres viejas. La posibilidad de que estas isoformas de la ApoA-IV se relacionen con proteínas incluidas en procesos de división celular y segregación cromosómica, puede también ser considerada.

El proceso de envejecimiento que lleva a la no-disyunción o pérdida del cromosoma X, en mujeres de edad avanzada ciertamente depende de la acción de múltiples factores genéticos, cuyas funciones biológicas normales no están todavía comprendidas. El conocimiento de estos genes, sus funciones y sus mecanismos de acción, podrá prevenir daños celulares, alteraciones en la división celular, muerte celular, proporcionando mejor comprensión forneciendo la prevención, diagnóstico, pronóstico y terapia en las enfermedades asociadas a la vejez.

REFERENCIAS BIBLIOGRÁFICAS

Avramopoulos, D.; Mikkelsen, M.; Vassilopoulos, D.; Grigoriadou, M. & Petersen, M.B. Apolipoprotein E allele distribution in parents of Down's syndrome children. Lancet, 347:862-5, 1996.         [ Links ]

Bukvic N, Gentile M, Susca F, Fanelli M, Serio G, Buonadonna L, Capurso A, Guanti G. Sex chromosome loss, micronuclei, sister chromatid exchange and aging: a study including 16 centenarians. Mutat. Res., 498:159-67, 2001.         [ Links ]

Catalán, J.; Falck, G. C. M. & Norppa, H. The X chromosome frequently Lags Behind in femele lymphocyte anaphase. Am. J. Human Genet., 66:687-91, 2000.         [ Links ]

Duverger, N.; Tremp, G.; Caillaud, J. M.; Emanuel, F.; Castro G.; Fruchart, J. C.; Steinmetz, A. & Denefle P. Protection against atherogenesis in mice mediated by human apoliprotein A-IV. Science, 273:966-8, 1996.         [ Links ]

Ejchel, T. F.; Araújo, L. M. Q.; Ramos, L. R.; Cendoroglo, M. S. & Smith, M. A. C. Association of the apolipoprotein A-IV:360 gln/his polymorphism with cerebrovascular disease, obesity and depression in a brazilian elderly population. Genet. Mol. Biol., submitted, 2004.         [ Links ]

Ezquerra, M.; Ballesta, F.; Queralt, R.; Aledo, R.; Gomez, D.; Guitart, M.; Egozcue, J.; Ascaso, C. & Oliva, R. Apolipoprotein E epsilon 4 alleles and meiotic origin of non-disjunction in Down syndrome children and in their corresponding fathers and mothers. Neurosci. Lett. 248:1-4, 1998.         [ Links ]

Ford, J. H. & Russel, J. A. Differences in the error mechanisms affecting sex and autosomal chromosomes in women of different ages within the reproductive age group. Am. J. Hum. Genet., 37:973-83, 1985.         [ Links ]

Geller, L. N. & Potter, H. Chromosome missegregation and trisomy 21 mosaicism in Alzheimer's disease. Neurobiol. Dis., 6:167-79, 1999.         [ Links ]

Guttenbach, M.; Koschorz, B.; Bernthaler, U.; Grimm, T. & Schmid, M. Sex chromosome loss and aging: in situ hybridization studies on human interphase nuclei. Am. J. Hum. Genet., 57:1143-50, 1995.         [ Links ]

Guttenbach, M.; Schakowski, R. & Schmid, M. Aneuploidy and ageing: sex chromosome exclusion into micronuclei. Hum. Genet., 94:295-8, 1994.         [ Links ]

Hando, J. C.; Joginger, N. & Tucker, J.D. Sex chromosomes micronuclei and aging in women,. Chromosoma, 103: 186-92, 1994.         [ Links ]

Hixson, J. E. & Vernier D. T. Restriction isotyping of human apolipoprotein A-IV: rapid typing of known isoforms and detection of a new isoform that deletes a conserved repeat. J. Lipid. Res., 32:1529-35, 1991.         [ Links ]

Jacobs, P. A.; Brunton, M.; Court-Brown, W. N.; Doll, R. & Goldstein, H. Change of human chromosome count distributions with age: evidence for a sex difference. Nature, 197:1080-1, 1963.         [ Links ]

Jacobs, P.A.; Court Brown, W. N. & Doll, R. Distribution of human chromosome counts in relation to age. Nature, 191:1178-80, 1961.         [ Links ]

Kormann-Bortolotto; M. H.; Smith, M. A. C. & Neto, J. T. Alzheimer's Disease and Aging: A Chromosomal Approach. Geronotology, 39:1-6, 1993.         [ Links ]

Lohse, P.; Kindt.; M. R.; Rader, D. J. Brewer, H. B. Jr. Genetic pholymorphism in human plasma apolipoprotein A-IV is due to nucleotide substitutions in the apolipoprotein A-IV gene. J. Biol. Chem., 265:10061-4, 1990.         [ Links ]

Moorhead, P. S.; Nowell, P. S.; Mellmann, W. J.; Battips, D. M. & Hunger-Ford, D. A. Chromosome preparations of leucocytes cultured from human peripheral blood. Exp. Cell Res., 20:613-6, 1960.         [ Links ]

Nagy, B.; Ban, Z.; Toth-Pal, E.; Papp, C.; Fintor, L. & Papp, Z. Apolipoprotein E allele distribution in trisomy 13, 18, and 21 conceptuses in a Hungarian population. Am. J. Clin. Pathol., 113:535-8, 2000.         [ Links ]

Petersen, M.B.; Karadima, G.; Samaritaki, M.; Avramopoulos, D.; Vassilopoulos, D. & Mikkelsen, M. Association between presenilin-1 polymorphism and maternal meiosis II errors in Down syndrome. Am. J. Med. Genet., 93:366-72, 2000.         [ Links ]

Ordovas, J. M.; Cassidy, D. K.; Civeira, F.; Bisgaier, C. L. & Schaefer, E. J. Familial apolipoprotein A-I, C-III, and A-IV deficiency and premature atherosclerosis due to deletion of a gene conplex on chromosome 11. J. Biol. Chem., 264:16339-42, 1989.         [ Links ]

Otha, T.; Fidge, N. H. & Nestel, P. J. Studies on the in vivo and in vitro distribution of apolipoprotein A-IV in human plasma and lymph. J. Clin. Invest., 76:1252-60, 1985.         [ Links ]

Pinkel, D.; Straume, T. & Gray, J. W. Cytogenetic analysis using quantitative, high-sensitivity, fluorescence hybridization. Proc. Natl. Acad. Sci. U.S.A., 83:2934-8, 1986.         [ Links ]

Qin, X.; Swertfeger, D. K.; Zheng, S.; Hui, D. Y. & Tso, P. Apolipoprotein AIV: a potent endogenous inhibitor of lipid oxidation. Am. J. Physiol., 274: H1836-H1840, 1998.         [ Links ]

Rader, D. J.; Schafer, J.; Lohse, P.; Verges, B.; Kindt, M.; Zech, L. A.; Steinmetz, A. & Brewer, H. B. Jr. Rapid in vivo transport and catabolism of human apolipoprotein A-IV-1 and slower catabolism of the apoA-IV-2 isoprotein. J. Clin. Invest., 92:1009-17, 1993.         [ Links ]

Ramos, L. R.; Toniolo, N. J.; Cendoroglo, M. S.; Garcia, J. T.; Najas, M. S.; Perracini, M.; Paola C. R.; Santos, F. C.; Bilton, T.; Ebel, S. J.; Macedo, M. B. M.; Almada, F. C. M; Nasri, F.; Miranda, R. D.; Gonçalves, M.; Santos, A. L. P.; Fraietta, R.; Vivacqua, N.I.; Alves, M. L. M. & Tudisco, E. S. Two-year follow-up study of elderly residents in S. Paulo, Brazil: Methodology and preliminary results. Rev. Saúde Pública, 32:397-407, 1998.         [ Links ]

Tenkanen, H. Genotyping of apolipoprotein A-IV by digestion of amplified DNA with restriction endonuclease Fnu4H1: use of tailored primer to abolish additional recognition sites during the gene amplification. J. Lipid. Res., 30:545-9, 1989.         [ Links ]

Weinberg, R. B.; Dantzker, C. & Patton, C.S. Sensitivity of serum apolipoprotein A-IV levels to changes in dietary fat content.Gastroenterology, 98:17-24, 1990.         [ Links ]

Weinberg, R. B. & Spector M. S. Human apolipoprotein A-IV: displacement from the surface of triglyceride-rich particles by HDL2-associated C-apoproteins. J. Lipid. Res., 26:26-37, 1985.         [ Links ]

Dirección para correspondencia

Prof. Dra. Marília de Arruda Cardoso Smith
Disciplina de Genética, Departamento de Morfologia
Universidad Federal de São Paulo,
Escola Paulista de Medicina
Rua Botucatu, 740
CEP 04023-900
São Paulo, SP
BRASIL

e-mail: macsmith.morf@epm.br

Recibido : 20-02-2004
Aceptado : 02-04-2004

 

Creative Commons License Todo el contenido de esta revista, excepto dónde está identificado, está bajo una Licencia Creative Commons