SciELO - Scientific Electronic Library Online

 
vol.35 número3Concentración iónica y metales pesados en el agua de riego de la cuenca del río Ayuquila-Tuxcacuesco-ArmeríaIndicadores de sostenibilidad para un cultivo de pimiento en el valle de Azapa, Arica, Chile índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Idesia (Arica)

versión On-line ISSN 0718-3429

Idesia vol.35 no.3 Arica set. 2017

http://dx.doi.org/10.4067/S0718-34292017005000304 

Artículos de Investigación

Caracterización molecular del gen psbA en Chenopodium quinoa Willd

Molecular characterization of the psbA gene in Chenopodium quinoa Willd

Camilo Mestanza 1   3  

Ricardo Riegel 2  

Diana Véliz 3  

Santiago C. Vásquez 1   4  

Hayron Fabricio Canchignia Martínez 3  

Jaime Vera Chang 3  

Olry Fernando Cevallos Falquez 3  

1 Escuela de Graduados, Facultad de Ciencias Agrarias, Universidad Austral de Chile, Campus Isla Teja, Valdivia, Chile.

2 Instituto de Producción y Sanidad Vegetal, Facultad de Ciencias Agrarias, Universidad Austral de Chile, Campus Isla Teja, Valdivia, Chile.

3 Universidad Técnica Estatal de Quevedo, Quevedo, Ecuador.

4 Universidad Politécnica Salesiana, Cuenca, Ecuador.

RESUMEN

La quinua es un grano sagrado de origen andino cuya popularidad se debe a sus excelentes características nutricionales y amplia plasticidad fenotípica. Es una especie vegetal que muestra una condición mayoritaria de autogamía, con ciertos niveles de alogamia. El gen psbA presente en el cloroplasto, mayoritariamente descrito en plantas con herencia maternal, codifica para la proteína D1. Esta proteína está relacionada con la fotosíntesis, así como también es un gen objetivo de distintos herbicidas, debido a que hay varias familias químicas que inhiben la acción de la proteína D1. Basado en estos antecedentes se procedió a caracterizar el gen psbA en el cultivar de quinua Regalona-Baer. Para realizar la caracterización molecular, primeramente se extrajo el ADN, luego se realizó la Reacción en Cadena de la Polimerasa (PCR), utilizando la información de las bases de datos de especies relacionadas. Los resultados muestran que el gen psbA en la quinua tiene una simple copia, con un total de 1.062 nucleótidos, generando 354 aminoácidos incluyendo el codón de "parada". El tamaño total de la secuencia que codifica el gen psbA mostró un tamaño similar a las 300 secuencias de genes psbA existentes en "La base de datos genoma del cloroplasto". El gen psbA podría ser el comienzo para explorar la diversidad en el genoma del cloroplasto de la quinua, conocer el tipo de segregación extracromosomal y sobre todo el potencial de poder generar cultivares con resistencia a herbicidas asociados a este gen.

Palabras claves: cloroplasto; grano andino; proteína D1; quinua

ABSTRACT

Quinoa is a sacred grain of Andean origin whosepopularity is due to its excellent nutritional characteristics and broadphenotypic plasticity. It is a plant species that shows a majority condition of autogamy, with certain levels of alogamy. The psbA gene present in the chloroplast, mostly described in plants with maternal inheritance, codes for D1 protein. This protein is related to photo-synthesis, as well as a target gene of different herbicides, since there are several chemical families that inhibit the action of D1 protein. Based on this background, we proceeded to characterize the psbA gene in the Regalona-Baer quinoa cultivar. To perform the molecular characterization, the DNA was first extracted, and then the Polymerase Chain Reaction (PCR) was performed, using information from the related species databases. The results show that the psbA gene in quinoa has a single copy, with a total of 1062 nucleotides, generating 354 amino acids including the "stop" codon. The total size of the sequence encoding the psbA gene showed a similar size to the 300 sequences of psbA genes existing in "The Chloroplast Genome Database". The psbA gene could be the beginning to explore the diversity in the chloroplast genome of quinoa, to know the type of extra-chromosomal segregation and, above all, the potential to be able to generate herbicide-resistant cultivars associated with this gene.

Key words: Andean grain; chloroplast; D1 protein; quinua

Introducción

La quinoa (Chenopodium quinoa Willd) pertenece a la familia Amarantaceae, subfamilia Chenopodioideae. Este género consiste en alrededor de 250 especies incluyendo especies herbáceas, leñosas y arbustivas, siendo la mayoría de ellas anuales. Las especies del género Chenopodium han sido cultivadas por siglos, ya sea como hoja en fresco (Chenopodium álbum, Chenopodium ambrosioides), o como cultivos de grano (C. quinoa y C. álbum) para alimentación humana y animal, debido a su alto contenido de proteína y buen balance de aminoácidos (Bhargava, Shukla, & Ohri, 2003).

La quinoa es considerada como un cultivo marginal, subutilizado dentro de la agricultura; pese a estar relacionado con varios cultivos agrícolas importantes como la remolacha (Beta vulgaris), espinaca (Spinacia oleracea) y el amaranto (Amaranthus spp). En las últimas décadas el interés por la quinoa fuera de Sudamérica ha crecido enérgicamente. Esto, debido a su riqueza nutricional, así como también a su habilidad para adaptarse a un amplio rango de condiciones agroecológicas y su alto nivel de resistencia en ambientes marginales (Iqbal, 2015). Esta habilidad adaptativa a diferentes ambientes de algunos cultivares dentro de una especie, radica en gran medida a su diversidad genética (Gilchrist et al., 2006). Los objetivos y esfuerzos del mejoramiento genético de la quinua en Sudamérica, se han enfocado en desarrollar variedades de semillas grandes, de tipo dulces y amargas, con un mayor potencial de rendimiento (Zurita-Silva et al., 2014). Sin embargo, ningún estudio a la fecha se ha enfocado en profundidad en algunos de los principales problemas que impiden su masificación, como son el control de malezas. El control de malezas es uno de los factores que restringe la masificación del cultivo de quinoa. Un ineficiente control de malezas, puede reducir los rendimientos del cultivo, debido a que no existe un método químico que permita realizar un control selectivo; así como también, aumentos de jornales para el control manual incrementa los costos de producción (Ruiz et al., 2013). Por otro lado, la quinua es una especie Ginomonoica, que contiene flores hermafroditas y femeninas en la misma planta, generando una condición de autogamia o alogamia. Lo que en condición natural le permite autopolinizarse, o poder recibir el polen de una planta distinta. En las plantas superiores el estudio de herencia monoparental y biparental se ha basado en estudios de genes del cloroplasto, dado que por su haploidía este presenta una sola copia (Mulo, Sicora, & Aro, 2009). Uno de los genes en los que se han realizado investigaciones de herencia del cloroplasto en otras especies vegetales es el gen psbA (Steinback, Mcintoshtt, Bogoradt, & Arntzen, 1981). El gen psbA fue secuenciado por primera vez en Spinacea oleracea y Nicotiana debneyi, y desde entonces ha sido clonado y secuenciado en varios organismos fotosintéticos revelando que está altamente conservado (Holt, Powles, & Holtum, 1993). Por otro lado, el gen psbA codifica para la proteína D1 que es blanco de herbicidas inhibidores de la fotosíntesis, especialmente del fotosistema II (PSII) (Mazur & Falco, 1989). Los herbicidas PSII se unen a la proteína D1 y desplazan a la plastoquinona bloqueando el transporte de electrones fotosintéticos a PSII (Vermaas, 1984). Entre los herbicidas que tienen a la proteína D1 como sitio de acción, tenemos grupos químicos estructuralmente diversos como: triazinas, triazinonas, uracilos, ureas, biscarbamatos (Powles & Yu, 2010). La resistencia a herbicidas inhibidores PSII en plantas superiores fue descrita por primera vez en 1970 en Senecio vulgaris (resistencia a triazinas). En varias especies de plantas, la tolerancia a las triazinas se debe a una alteración del sitio de unión del herbicida o proteína objetivo (proteína D1, sitio de unión QB). Al ser una resistencia codificada por un gen del cloroplasto, dicha resistencia es heredada maternalmente (Powles & Yu, 2010).

Considerando que la quinua es una especie que aún no ha logrado posicionarse como un cultivo importante, pese a tener un gran potencial alimenticio, económico y como planta modelo para estudios de adaptabilidad fenotípica, y que además posee algunos factores que impiden su masificación, es necesario empezar a explorar algunos genes con importancia agronómica y evolutiva. Dentro de esta exploración el objetivo de este trabajo fue caracterizar molecularmente el gen psbA, debido a su importancia como gen objetivo para ser utilizado en la resistencia a herbicidas, así como también conocer los patrones de herencia extracromosomal.

Materiales y Métodos

Material vegetal y extracción de ADN

Como material vegetal se emplearon plántulas de quinua de la variedad Regalona-Baer. Las semillas fueron sembradas en macetas de 300 ml con una mezcla de suelo/arena y cultivadas en el invernadero del Instituto de Producción y Protección Vegetal de la Facultad de Ciencias Agrarias de la Universidad Austral de Chile. Las condiciones de temperatura de crecimiento fueron 20/12 °C día / noche (± 4 °C) con un régimen de luz de 14/10 h día/noche y 900 mol m-2 s-1 de intensidad luminosa.

Los tejidos foliares fueron cosechados de plantas individuales cuando tenían cuatro hojas verdaderas (aproximadamente 15 después de la siembra). La extracción de ADN se realizó usando un protocolo CTAB modificado (Arismendi, Andrade, Riegel, & Carrillo, 2010) en el Laboratorio de Biología Molecular de la Facultad de Ciencias Agrarias. El ADN aislado se cuantificó midiendo la absorbancia a 260 nm, y se diluyó con agua destilada a una concentración aproximada de 20 ng ul-1 y se almacenó a -20 °C para análisis futuros.

Selección y diseño de partidores para la amplificación del gen psbA

Se diseñaron y seleccionaron varios partidores para amplificar el gen psbA. En primer lugar, la selección y el diseño se realizó utilizando información de especies relacionadas filogenéticamente como Chenopodium rubrum, Spinacia oleracea, Amaranthus hybridus, Amaranthus retroflexus y Beta vulgaris. Posteriormente se identificaron las regiones conservadas de la secuencia y finalmente el diseño se llevó a efecto con el programa en línea Primer 3 (Rozen & Skaletsky, 2000).

Reacción en cadena de la polimerasa (PCR) para la amplificación del gen psbA y secuenciación directa

Se usaron múltiples combinaciones de partidores para amplificar el gen psbA. Las reacciones de amplificación contenían 2 de ADN total (20 ng µl-1), 2 µl de cada partidor (10 µM), 4 ul de MgCl2 (25 mM), 2 µl de cada dNTP (2,5 mM), 2 unidades de Platino Taq ADN polimerasa y 5 µl de tampón 10X suministrado con la enzima, en un volumen final de 50 µl.

El protocolo de amplificación consistió en una incubación durante 3 min a 94 °C, 34 ciclos de 35 s a 94 °C, 45 s a X °C y 1,45 minutos a 72 °C, y una extensión final de 7 min a 72 °C, donde X es la temperatura de alineamiento para cada par de partidores utilizados. Los productos de amplificación se analizaron mediante electroforesis en gel en 1,2% de agarosa 1X tampón TAE con bromuro de etidio durante 30 minutos a 100 voltios. Las bandas de ADN se visualizaron bajo luz UV, mismas que fueron comparadas con un marcador de peso molecular conocido y finalmente se fotografiaron.

Los fragmentos de interés que fueron seleccionados, se enviaron a Macrogen Inc., Corea para la secuenciación, solicitando primeramente una purificación de los productos de PCR. Las secuencias obtenidas fueron analizadas y editadas utilizando los programas de computación Bioedit y Chromas. La confirmación de la identidad de la secuencia consenso se realizó utilizando el algoritmo nucleótido Blast y BlastX del portal NCBI.

Análisis de las secuencias

Para determinar las secuencias de aminoácidos (aa), se empleó la herramienta de traducción en línea ExPASy. Por medio del programa en línea ClustalW se realizó la comparación de los cambios nucleotídicos y aminoacídicos, para verificar las mutaciones a nivel de ADN y proteína, respectivamente.

La secuencia consenso obtenida de C. quinoa y las descritas para otras especies se emplearon para construir árboles filogenéticos, con el objetivo de inferir la relación hipotética existente. Para realizar la filogenia, se utilizó el método de Máxima Parsimonia existente en el programa MEGA. El árbol se obtuvo utilizando el algoritmo Close-Neighbor-Interchange (CNI). Todas las posiciones que contenían vacíos y datos faltantes fueron excluidas del análisis. Para probar la robustez de la hipótesis de las relaciones filogenéticas se aplicó un análisis Bootstrap con mil réplicas.

Resultados

Aislamiento e identificación del gen psbA en C. quinoa

Se emplearon tres partidores forward y tres rever se, los que generaron un total de nueve combinaciones posibles. Numerosos fragmentos obtenidos tuvieron una mala calidad de amplificación. Además, hubo algunas combinaciones que no lograron amplificar el fragmento esperado. Los mejores fragmentos de PCR seleccionados para la secuenciación fueron: PSBCQF1: 5'GATGATTAAATTAAATAAACCAAG3' -PSBCQR3: 5'GGAACCATGCATAGCACTAAA3', 683 pb; PSBCQF2: 5'CCAAGATTTTACCAT GACTGC3' - PSBCQR2: 5'ACGAAATTTTATCCA TTTGTAG3', 1083 pb; PSBCQF3: 5'TTTA GTGCTATGCATGGTTCC3' - PSBCQR2: 5'ACGA AATTTTATCCATTTGTAG3', 440 pb) los cuales abarcaban un tamaño consenso de 1.102 pares de bases (pb) (Figura 1). Esta secuencia consenso se obtuvo posterior al resultado de la secuenciación en ambos sentidos de los fragmentos seleccionados, así como también al análisis de las zonas de traslape entre los amplicones y ensamble de los mismos.

Figura 1 Reacción en cadena de la polimerasa (PCR) utilizada para la amplificación del gen psbA en C. quinoa. Las flechas indican los mejores resultados, fragmentos seleccionados para la secuenciación. 

Las secuencias de quinua obtenidas, fueron editadas y analizadas, logrando obtener una secuencia consenso que fue depositada en la base de datos (GenBank: KM236238). Esta secuencia mostró un 98,59% de identidad con Chenopodium rubrum (Y14732.1), 97,55% con Spinacia oleracea (AJ400848.1) y 97,36% con Beta vulgaris (KJ081864.1), todos miembros de la subfamilia chenopodioideae. Mientras que, 95,95% de identidad se reportó con Amaranthus hybridus (K01200.1) y Amaranthus retroflexus (DQ887374.1), miembros de la subfamilia amaranthoideae.

Las relaciones filogenéticas inferidas entre varias secuencias de genes psbA disponibles en las bases de datos, agrupan a la secuencia psbA de C. quinoa dentro de la familia Amaranthoideae y más específicamente dentro de la subfamilia Chenopodioideae (Figura 2).

Figura 2 Relaciones filogenéticas hipotéticas entre las se cuencias psbA de plantas incluyendo la nueva secuencia de C. quinoa inferida por máxima parsimonia. Los números en los nodos representan valores bootstrap (1.000 repeticiones). Amaranthus hybridus (GenBank: K01200.1), Amaranthus retroflexus (DQ887374.1), Spinacia oleracea (AJ400848.1), Beta vulgaris (KJ081864.1), Chenopodium quinoa (KM236238), Chenopodium rubrum (Y14732.1), Phaseolus vulgaris (NC_009259.1), Medicago truncatula (XM_003636287.1) y Oryza sativa (JN861109.1). 

El análisis completo de secuencia de quinua muestra que es un gen no interrumpido por intrones, de copia única con un total de 1.062 nucleótidos y 354 aminoácidos incluyendo el codón "stop". Tamaño similar a todas las secuencias utilizadas en el análisis de la filogenia.

El análisis de la secuencia de quinua y la especie más cercana C. rubrum, reveló la presencia de 15 sitios polimórficos que son sinónimos (estas mutaciones no produjeron cambios de aminoácidos) debido a la redundancia del código genético. Mientras que con Oryza sativa, especies más distantes, registró 84 sitios polimórficos, de los que solo cuatro se generaron sustituciones no sinónimos: codón 11 (gaa/aca), 346 (atc/ctt), 348 (gct/gtt) y 351 (aca/ctt), generando cambios de aminoácidos E/T, I/L, A/V y T/L, respectivamente.

Discusión

El tamaño total de la secuencia que codifica el gen psbA en C. quinoa (1062 pb) mostró un tamaño similar a las 300 secuencias existentes en los genes psbA en "The Chloroplast Genome Database" (http:// chloroplast.ocean.washington.edu/tools/cpbase/run?u_feature_id=35444&view=universal_feature), correspondiente al taxón Viridiplantae, que tiene 1.062 pb. Las principales diferencias entre algunas secuencias analizadas corresponden a sustituciones, principalmente por polimorfismos localizados en las regiones N-terminales y C-terminal de la proteína (Figura 3). Estas regiones están implicadas en otros procesos, como el de transporte y localización, y no en la actividad catalítica de la enzima (Duggleby & Pang, 2000).

Figura 3 Alineación de aminoácidos de la proteína D1: Amaranthus hybridus (GenBank: K01200.1), Amaranthus retroflexus (DQ887374.1), Spinacia oleracea (AJ400848.1), Beta vulgaris (KJ081864.1), Chenopodium quinoa (KM236238), Chenopodium rubrum (Y14732.1), Phaseolus vulgaris (NC_009259.1), Medicago truncatula (XM_003636287.1) y Oryza sativa (JN861109.1). Los espacios blancos muestran sitios polimórficos.  

El gen psbA en quinua presenta una copia única ininterrumpida, situación y ubicación similar a la descrito en Spinacia oleracea, misma que se dispone en la región larga de simple copia (LSC) cercano a la región de repeticiones invertidas (IR) (Figura 4). Organización que podríamos tomar en cuenta al ser la especie filogenéticamente más cercana a quinoa, que tiene secuenciado el genoma del cloroplasto por completo (Schmitz-Linneweber et al., 2001; http://chloroplast.ocean).

Figura 4 Configuración cuatripartita del genoma circular del cloroplasto en Spinacia oleracea. Flecha azul señala ubicación del gen psbA. 

Por otro lado, cabe mencionar que, en algas verdes el psbA contiene intrones y puede estar presente en dos copias (por ejemplo, Chlamydomonas reinhardtii). En las cianobacterias, el psbA se encuentra como una pequeña familia de genes multicopia de generalmente tres (por ejemplo, Synechocystis PCC 6803), pero a veces cuatro miembros [(Anabaena 7120, (Vrba & Curtis, 1990)].

El gen psbA está codificado en los cloroplastos, orgánulos que contienen toda la maquinaria enzimática necesaria para la fotosíntesis y otras vías bioquímicas. Aunque la mayoría de las plantas terrestres tienen un polipéptido D1 altamente conservado y el genoma del cloroplasto organizado en un solo cromosoma circular, existen regiones con polimorfismos de alta secuencia que a menudo se observan incluso entre especies estrechamente relacionadas (Kim & Jansent, 1995). Varios reordenamientos de secuencias en genomas de cloroplasto de diferentes especies de plantas han sido reportados (Tangphatsornruang et al., 2011). Se ha propuesto que los eventos de recombinación intramolecular son las causas de reordenamientos secuenciales en los genomas del cloroplasto (Hiratsuka et al., 1989).

La importancia de los genes (psbA) y los genomas del cloroplasto, es que proporcionan ricas fuentes de información filogenética, y numerosos estudios que utilizan secuencias de ADN del cloroplasto se han llevado a efecto durante las últimas dos décadas, aumentando mucho nuestra comprensión de las relaciones evolutivas entre angiospermas (Jansen et al., 2007). Además de su función central de fotosíntesis, los cloroplastos también participan en la biosíntesis de almidón, ácidos grasos, pigmentos y aminoácidos (Neuhaus & Emes, 2000). Y, una estrategia para mejorar una especie vegetal es mediante la ingeniería genética del cloroplasto para agregar rasgos agronómicos de alto valor por medio de la expresión transgénica (De Cosa, Moar, Lee, Miller, & Daniell, 2001), que es muy ventajosa comparada con la transformación del genoma nuclear, principalmente porque puede generar altos niveles de expresión y el ADN recombinante se contiene más fácilmente, ya que los cloroplastos son heredados por la madre en la mayoría de las especies de angiospermas (Hagemann, 2004). En este sentido, el gen psbA podría ser el escáner inicial de diversidad y organización del genoma del cloroplasto en la quinua.

Literatura Citada

Arismendi, N.; Andrade, N.; Riegel, R. & Carrillo, R. 2010. Presence of a phytoplasma associated with witches' broom disease in Ugni molinae Turcz. and Gaultheria phillyreifolia (Pers.) Sleumer determined by DAPI, PCR, and DNA sequencing. Chilean Journal of Agricultural Research, 70 (1): 26-33. [ Links ]

Bhargava, A.; Shukla, S. & Ohri, D. 2003. Genetic variability and heritability of selected traits during different cuttings of vegetable Chenopodium. The Indian Journal of Genetics and Plant Breeding, 63 (4): 359-360. [ Links ]

Coles, N.D.D.; Coleman, C.E.E.; Christensen, S.A.; Jellen, E.N.N.; Stevens, M.R.R.; Bonifacio, A.; . Maughan, P.J. 2005. Development and use of an expressed sequenced tag library in quinoa (Chenopodium quinoa Willd.) for the discovery of single nucleotide polymorphisms. Plant Science, 168 (2): 439-447. [ Links ]

De Cosa, B.; Moar, W.; Lee, S.B.; Miller, M. & Daniell, H. 2001. Overexpression of the Bt cry2Aa2 operon in chloroplasts leads to formation of insecticidal crystals. Nature Biotechnology, 19 (1): 71-4. [ Links ]

Duggleby, R.G. & Pang, S.S. 2000. Acetohydroxyacid Synthase. Journal of Biochemistry and Molecular Biology, 33 (1): 1-36. [ Links ]

Gilchrist, E.J.; Haughn, G.W.; Ying, C.C.; Otto, S.P.; Zhuang, J.; Cheung, D.; Cronk, Q.C.B. 2006. Use of Ecotilling as an efficient SNP discovery tool to survey genetic variation in wild populations of Populus trichocarpa. Molecular Ecology, 15 (5): 1367-1378. [ Links ]

Hagemann, R. 2004. The Sexual Inheritance of Plant Organelles. In: Molecular Biology and Biotechnology of Plant Organelles: Chloroplasts and Mitochondria. Daniell, H.; Chase, C.D. (Eds.). Springer Netherlands. Dordrecht, The Netherlands. pp. 93-113. [ Links ]

Hiratsuka, J.; Shimada, H.; Whittier, R.; Ishibashi, T.; Sakamoto, M.; Mori, M.; Sugiura, M. 1989. The complete sequence of the rice (Oryza sativa) chloroplast genome: Intermolecular recombination between distinct tRNA genes accounts for a major plastid DNA inversion during the evolution of the cereals. Molecular and General Genetics, 217 (2-3): 185-194. [ Links ]

Holt, J.; Powles, S.B. & Holtum, J.A.M. 1993. Mechanisms and Agronomic Aspects of Herbicide Resistance. Annu. Rev. Plant Physiol. Plant Mol. Biol ., 44: 203-29. [ Links ]

Iqbal, M.A. 2015. An Assessment of Quinoa ( Chenopodium quinoa Willd .) Potential as a Grain Crop on Marginal Lands in Pakistan. American-Eurasian J. Agric. & Environ. Sci., 15 (1): 16-23. [ Links ]

Jansen, R.K.; Cai, Z.; Raubeson, L.A.; Daniell, H.; Depamphilis, C.W.; Leebens-Mack, J.; Boore, J.L. 2007. Analysis of 81 genes from 64 plastid genomes resolves relationships in angiosperms and identifies genome-scale evolutionary patterns. Proc. Natl. Acad. Sci. USA, 104 (49): 19369-74. [ Links ]

Kim, K. & Jansent, R.K. 1995. ndhF sequence evolution and the major clades in the sunflower family. Proc. Natl. Acad. Sci. USA, 92: 10379-10383. [ Links ]

Mazur, B.J. & Falco, S.C. 1989. The development of herbicide resist ant crops. Annu. Rev. Plant Physiol. Plant Mol. Biol ., 40: 441-470. [ Links ]

Mulo, P.; Sicora, C. & Aro, E.-M. 2009. Cyanobacterial psbA gene family: optimization of oxygenic photosynthesis. Cellular and Molecular Life Sciences, 66 (23): 3697-3710. [ Links ]

Neuhaus, H. & Emes, M. 2000. Nonphotosynthetic metabolism in plastids. Annu. Rev. Plant Physiol. Plant Mol. Biol ., 51, 111-140. [ Links ]

Powles, S.B. & Yu, Q. 2010. Evolution in action: plants resistant to herbicides. Annu Rev Plant Biol, 61: 317-47. [ Links ]

Raubeson, L.A. & Jansen, R.K. 1992. Chloroplast DNA evidence on the ancient evolutionary split in vascular land plants. Science, 255 (5052): 1697-9. [ Links ]

Rozen, S. & Skaletsky, H. 2000. Primer 3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology, 132: 365-386. [ Links ]

Ruiz, K.B.; Biondi, S.; Oses, R.; Acuña Rodríguez, I.S.; Antognoni, F.; Martinez Mosqueira, E.A.; Molina Montenegro, M.A. 2013 Quinoa biodiversity and sustainability for food security under climate change. A review. Agronomy for Sustainable Development, 34 (2): 349-359. [ Links ]

Schmitz-Linneweber, C.; Maier, R.M.; Alcaraz, J.P.; Cottet, A.; Herrmann, R.G. & Mache, R. 2001. The plastid chromosome of spinach (Spinacia oleracea): complete nucleotide sequence and gene organization. Plant Molecular Biology, 45: 307-315. [ Links ]

Steinback, K.E.; Mcintoshtt, L.; Bogoradt, L. & Arntzen, C.J. 1981. Identification of the triazine receptor protein as a chloroplast gene product. Proc. Natl. Acad. Sci. USA, 78 (12): 7463-7467. [ Links ]

Tangphatsornruang, S.; Uthaipaisanwong, P.; Sangsrakru, D.; Chanprasert, J.; Yoocha, T.; Jomchai, N. & Tragoonrung, S. 2011. Characterization of the complete chloroplast genome of Hevea brasiliensis reveals genome rearrangement, RNA editing sites and phylogenetic relationships. Gene, 475 (2): 104-12. [ Links ]

Vermaas, W.F.J. 1984. Herbicide/Quinone Binding Interactions in Photosystem II. Z. Naturforsch ., 39: 368-373. [ Links ]

Vrba, J.M. & Curtis, S.E. 1990. Characterization of a four-member psbA gene family from the cyanobacterium Anabaena PCC 7120. Plant Molecular Biology, 14 (1): 81-92. [ Links ]

Zurita-Silva, A.; Fuentes, F.; Zamora, P.; Jacobsen, S.-E. & Schwember, A.R. 2014. Breeding quinoa (Chenopodium quinoa Willd.): potential and perspectives. Molecular Breeding, 34 (1): 13-30. [ Links ]

Recibido: 28 de Marzo de 2017; Aprobado: 19 de Julio de 2017

* Autor de correspondencia: cmestanza@uteq.edu.ec

Creative Commons License Este es un artículo publicado en acceso abierto bajo una licencia Creative Commons