nueva página del texto (beta)
Inglés (pdf)
Articulo en XML
Traducción automática
Citado por SciELO 
Citado por Google 
Similares en
SciELO 
Similares en Google 
Permalink
INTRODUCTION
Worldwide shrimp production has decreased mainly due to viral and bacterial diseases such as acute hepatopancreatic necrotizing disease (AHPND) and white spot disease (WSD) (Tran et al., 2013; Nunan et al., 2014; Joseph et al., 2015). Therefore, in the last years, the use of natural products such as probiotics, prebiotics, immunostimulants, and medicinal plants have become relevant to reduce mortalities (Peraza-Gómez et al., 2009, 2014; Huynh et al., 2011; Medina-Beltrán et al., 2012; Akhter et al., 2015). Natural products have potential as immunostimulants to prevent and cure diseases (Shukla et al., 2014). Crustaceans do not have a specific immune system with memory capacity (Barraco et al., 2008). Therefore, the innate immune response is based on reactive cells (hemocytes) and humoral molecular effectors. Hemocytes participate in phagocytosis, cytotoxicity, adhesion, cellular communication, recognition, encapsulation, and nodule formation (Chisholm & Smith, 1995; Johansson et al., 2000; Jiravanichpaisal et al., 2006; Lin et al., 2006; Yeh et al., 2009; Sivakamavalli et al., 2014). Humoral effectors include the prophenoloxidase cascade, clotting mechanism, lectins, lysosomal hydrolytic enzymes, lysozymes, antimicrobial peptides, and respiratory burst (Destoumieux et al., 2000; Campa-Córdova et al., 2005; Jiravanichpaisal et al., 2006; Cerenius et al., 2008).
Several plants have been found to have immunostimulant properties to increase resistance in shrimp against microbial diseases, such as Cardiospermum halicacubum in Penaeus monodon (Rajasekar et al., 2011) and Magnifera indica in Penaeus indicus (Harikrishnan et al., 2015). Among medicinal plants, Aloe vera has active constituents, including vitamins, minerals, polysaccharides (pectins, cellulose, hemicellulose, glucomannan, acemannan and mannose derivatives), amino acids, anthraquinones, enzymes, lignin, saponins, salicylic acids, carotenoids, steroids, terpenes, and phytosterols (Dagne et al., 2000; Boudreau & Beland, 2006). Glucomannan and acemannan have immunostimulant, antiviral, and antibacterial properties (Waihenya et al., 2002; Ferro et al., 2003; Mahdavi et al., 2013; Mojtaba & Esmail, 2013; Dotta et al., 2014). Also, the anthraquinone, aloeemodin, prevents virus adsorption and replication into the cell (Reynolds & Dweck, 1999; Hu et al., 2003; Li et al., 2014). The effect of plants on shrimp immune system can be analyzed using the expressions of immune-related genes as potential markers (Liu et al., 2006) since the mRNA provides information about the potential synthesis of a particular gene product (Sánchez-Paz et al., 2003).
In Penaeus vannamei, high survival was observed in animals fed A. vera and challenged with Vibrio parahaemolyticus, the causative agent of AHPND (Trejo-Flores et al., 2016). Therefore, the present study aimed to evaluate the effect of A. vera, added to the diet, on the expression of some immune-related genes in P. vannamei.
MATERIALS AND METHODS
Experimental animals
Shrimps were obtained from Proveedora de Larvas, S.A. de C.V. (Sinaloa, Mexico) and cultured in 1000 L plastic tanks with 500 L of filtered (salinity of 30) seawater and continuous aeration. Tanks were located in an outdoor culture area covered with a shadow mesh. Shrimps were fed twice daily at 09:00 and 17:00 h with commercial feed (Purina®, 35% protein) according to weight tables. Uneaten food and waste material were removed daily by siphoning. Shrimps were analyzed by PCR to verify that they were WSSV and IHHNV-free.
Shrimp acclimation to culture conditions
Shrimps were maintained for 3 days in 50-L glass aquaria containing 46 L of filtered (20 μm) seawater and under continuous aeration. Shrimps were fed as above. Uneaten food and waste material were removed daily by siphoning.
Preparation of the experimental diet with powdered Aloe vera
Whole leaves were sun-dried and ground in a Waring® blender. The powder obtained was then minced in a hammer mill (Thomas Scientific 3383-L60, GE Motors & Industrial Systems, USA) to obtain a fine powder. At the same time, commercial feed (Purina®, 35% protein) was pulverized in a coffee grinder.
A homogeneous paste with commercial feed, A. vera powder, grenetin, and distilled water was prepared. The concentration of the plant in the feed was based on the work of Trejo-Flores et al. (2016). The paste was prepared by adding 40 g of gelatin and 410 mL of distilled water to each kilogram of feed. Subsequently, the paste was pelletized in a meat grinder (Torrey®, model M-22 R, Monterrey, Nuevo León, Mexico) and then dried at room temperature with a fan for 24 h. The pelleted feed was stored at −20°C.
Bioassay (time series for gene expression)
A bioassay was conducted for 72 h in 50 L glass tanks with 50 shrimp (2.9 ± 0.8 g) and constant aeration. Six shrimps were removed at 0, 6, 12, 24, 48 and 72 h (Wang et al., 2008). Samples of time zero (control) were removed just before feeding with aloe (1 g kg-feed−1). After feeding with aloe during 24 h, uneaten food and waste material were removed by siphoning and then shrimp were fed only with the commercial feed. Hemolymph and hepatopancreas were sampled from each shrimp for the analysis of immune-related genes and fixed until their analyses. Shrimps were WSSV-free. Temperature ranged from 28.4 ± 1.2 to 28.9 ± 2.7°C; salinity was between 30.5 ± 1.4 and 30.9 ± 1.1, dissolved oxygen ranged from 5.6 ± 0.5 to 5.2 ± 0.3 mg mL−1, and pH was between 8.0 ± 0.4 and 8.1 ± 0.3.
Hemolymph and hepatopancreas extraction
Hemolymph (200 μL) was withdrawn from the pleopod base of the first abdominal segment with a sterile 1 mL syringe (27 G×13 mm needle) preloaded with 400 μL of a cooled anticoagulant solution (450 mM NaCl, 10 mM KCl, 10 mM Hepes, and 10 mM EDTA Na2, pH 7.3) (Vargas-Albores et al., 1993). Hemolymph was centrifuged at 800 g for 15 min at 4°C. The plasma was discarded, and the cell pellet was rinsed with 250 μL of cold anticoagulant by centrifuging as above. The supernatant was removed, and the hemocytes were suspended in 250 μL of cooled Trizol Reagent® (Invitrogen, Carlsbad, CA, USA) and stored at −70°C until use. A hepatopancreas sample was placed in cold RNAlater (Invitrogen®).
Total RNA isolation and cDNA synthesis
Total RNA was extracted from hemocytes and hepatopancreas with Trizol Reagent according to manufacturer's instructions. The concentration and purity of RNA were checked in a nanophotometer (Implen, Inc., Westlake Village, CA, USA). The RNA was treated with DNAse I (1 U μL−1, Sigma-Aldrich®, St. Louis, MO, USA). First-strand cDNA synthesis was performed from 500 ng of total RNA using reverse transcriptase (Improm II, Promega®, Madison, WI, USA) with the oligo dT20. The cDNA was diluted with 80 μL of ultrapure water and stored at −70°C until analysis. Five microliters of this cDNA dilution were used as template in each qRT-PCR reaction.
Expression analysis of immune-related genes by qPCR
The expression of immune-related genes in hemocytes (translationally controlled tumor protein [TCTP, GenBank EU305625], cytosolic manganese superoxide dismutase [cMnSOD, GenBank DQ298207.1], and penaeidin4 [GenBank DQ211701]) and hepatopancreas (heat shock protein 70 [HSP70, GenBank JQ736788]) was determined by quantitative real-time PCR using a CFX96 system and the CFX Manager version 3.0 (Bio-Rad Laboratories, Hercules, CA, USA) (Table 1). Penaeidin4, TCTP, and SOD were determined in hemocytes because these molecules are crucial in the immune function of hemocytes against the pathogen. Hepatopancreas has been previously reported to be a sensitive tissue in crustaceans (Bhavan & Geraldine, 2001). Therefore, the impact of A. vera on the digestive gland during digestion was analyzed through the expression of HSP70 since this gene plays an important role in stress and the defense against microbial infections in shrimp (Rungrassamee et al., 2010).
Table 1 Specific primers used for qPCR amplification of housekeeping and immune-related genes of P. vannamei.
| Genes | Primers | Sequence (5’-3’) | References |
|---|---|---|---|
| Immune-related | |||
| SOD | SOD-F | ATCCACCACACAAAGCATCA | Wang et al. (2010) |
| SOD-R | AGCTCTCGTCAATGGCTTGT | ||
| TCTP | TCTP-F | CAATGGACCCTGATGGC | Wu et al. (2013) |
| TCTP-R | GCTTCTCCTCTGTTAGACCGTAT | ||
| Penaeidin4 | Pen4-F | GCCCGTTACCCAAACCATC | Wang et al. (2010) |
| Pen4-R | CCGTATCTGAAGCAGCAAAGTC | ||
| HSP70 | hsp70 F | GGCAAGGAGCTGAACAAGTC | Flores-Miranda et al. (2014) |
| hsp70 R | TCTCGATACCCAGGGACAAG | ||
| Housekeeping | |||
| 40S-S24 | Lv40S S24-F | CAGGCCGATCAACTGTCC | Álvarez-Ruiz et al. (2015) |
| Lv40S_S24-R | CAATGAGAGCTTGCCTTTCC | ||
| Ubiquitin | Ubi-F | GGGAAGACCATCACCCTTG | |
| Ubi-R | TCAGACAGAGTGCGACCATC | ||
| EF1α | LvEf-F | CTGTGGTCTGGTTGGTGTTG | |
| LvEf-R | TCAGATGGGTTCTTGGGTTC | ||
| β-actin | Actin-F | CCACGAGACCACCTACAAC | Wang et al. (2008) |
| Actin-R | AGCGAGGGCAGTGATTTC |
To find the best normalization factor to evaluate the expression of target genes (Table 1), a stability analysis of four reference genes (40S-S24 [GenBank unpublished], β-actin [GenBank AF300705], EF1α [GenBank # GU136230], and ubiquitin [GenBank KJ831562]) was done with two algorithms: GeNorm (Vandesompele et al., 2002) and NormFinder (Andersen et al., 2004), using the RefFinder web application [http://150.216.56.64/referencegene.php]. Hence, hemocyte gene expression was normalized to the geometric mean of 40S-S24, β-actin, and ubiquitin expression. Hepatopancreas gene expression was normalized with β-actin, EF1α, and ubiquitin.
A qPCR master mix (2X) (1.5 μL of reaction buffer 10X, 0.75 μL of 50 mM MgCl2, 0.3 μL of 10 mM dNTPs, 0.75 μL of EvaGreen® 20x [Biotium, Hayward, CA, USA]; 0.1 μL of 5 U μL−1 Biolase DNA Polymerase [Bioline, Taunton, MA, USA], and 4.1 μL of ultrapure water) was prepared for all reactions of the experiment, separated in aliquots (reactions per plate), and stored at −20°C until use. Amplification was performed in duplicate in a 96-well plate in a 15 μL reaction volume containing 7.5 μL of PCR Master Mix 2X, 0.35 μL of each primer (10 μM, Sigma-Aldrich®), 1.8 μL of ultrapure water, and 5 μL of cDNA. Amplification conditions were as follows: 95°C for 3 min followed by 40 cycles of 95°C for 10 s, 60°C for 15 s, 72°C for 30 s, and 79°C for 5 s (to acquire fluorescence). After each reaction, a dissociation curve from 65 to 90°C was recorded at increments of 0.5°C and examined for unique and specific products.
For each gene, efficiency (E) of the PCR reaction was determined by calculating a slope with five serial dilutions (dilution factor of 5 or 10) of a representative pool of cDNA [E = 10(-1/slope)-1]. The efficiency of the genes was between 1.91 and 1.98. To calculate expression of target genes, Cq values were transformed to relative quantities (RQ) using the equation RQij = E[(Cq mean)–Cq(ij)], where E is the gene-specific efficiency in decimal plus one, and [(Cq mean – Cq(ij)] is the absolute difference for each Cq sample against the mean Cq in the dataset for each gene. Relative expression of each gene was calculated with the equation RQtarget/geometric mean of RQreference genes (Vandesompele et al., 2002).
RESULTS
Bioassay (shrimp immune response to Aloe vera)
To determine the transcriptional response of shrimp to A. vera added to feed, we evaluated mRNA expression of four immune-related genes in a serial course of time. The TCTP, cMnSOD, penaeidin4, and HSP70 gene expressions were modulated revealing the influence of A. vera.
Dietary A. vera significantly down-regulated the expression of TCTP in hemocytes. Conversely, the mRNA expression of cMnSOD and penaeidin4 genes was significantly up-regulated. The mRNA expression of TCTP gene was significantly down-regulated (P < 0.05) at 12, 24, 48 and 72 h after feeding with A. vera (Fig. 1). The mRNA expression of the cMnSOD gene was significantly up-regulated (P < 0.05) at 24, 48 and 72 h, but the reduction of its expression to the control level (0 h) was not observed in the time studied (Fig. 2). The mRNA expression of penaeidin4 was significantly up-regulated (P < 0.05) at 6 h and 12 h and the reduction of its expression to the control level (0 h) was observed from 24 h on (Fig. 3).
Figure 1 Relative expression of TCTP gene in hemocytes of P. vannamei fed with A. vera. Sampling (n = 6) times at 0, 6, 12, 24, 48 and 72 h. Relative expression was calculated with the equation RQtarget/geometric mean of RQreference genes. Reference genes: 40S-S24, β-actin, and ubiquitin. Results are mean ± SE. Different letters indicate significant differences (P < 0.05).
Figure 2 Relative expression of the cMnSOD gene in hemocytes of P. vannamei fed with A. vera. Sampling (n = 6) times at 0, 6, 12, 24, 48 and 72 h. Relative expression was calculated with the equation RQtarget/geometric mean of RQreference genes. Reference genes: 40S-S24, β-actin, and ubiquitin. Results are mean ± SE. Different letters indicate significant differences (P < 0.05).
Figure 3 Relative expression of penaeidin4 gene in hemocytes of P. vannamei fed with A. vera. Sampling (n = 6) times at 0, 6, 12, 24, 48 and 72 h. Relative expression was calculated with the equation RQtarget/geometric mean of RQreference genes. Reference genes: 40S-S24, β-actin, and ubiquitin. Results are mean ± SE. Different letters indicate significant differences (P < 0.05).
The dietary treatment significantly (P < 0.05) up-regulated the expression of HSP70 in the hepatopancreas at 48 h and 72 h, but the reduction of its expression to the control level (0 h) was not observed in the time studied (Fig. 4).
Figure 4 Relative expression of HSP70 gene in the hepatopancreas of P. vannamei fed with A. vera. Sampling (n = 6) times at 0, 6, 12, 24, 48 and 72 h. Relative expression was calculated with the equation RQtarget/geometric mean of RQreference genes. Reference genes: β-actin, EF1α, and ubiquitin. Results are mean ± SE. Different letters indicate significant differences (P < 0.05).
DISCUSSION
In the last years, medicinal plants have been used for the control and prevention of diseases of aquatic organisms (Citarasu et al., 2006; Huynh et al., 2011; Peraza-Gómez et al., 2011; Medina-Beltrán, 2012) as with P. vannamei, where A. vera protects animals from the infection with WSSV and V. parahaemolyticus (Trejo-Flores et al., 2016). Plant phytochemicals could be an alternative to the chemotherapeutic molecules due to antimicrobial and immunostimulant properties (Siravam et al., 2004; Kirubakaran et al., 2010). Although modulation of the immune response by plants has become the focus of scientific investigation (Galina et al., 2009), there are no reports on the effect of A. vera on the immune system of P. vannamei. Therefore, this paper aims to address this issue.
One of the studied immune effectors was TCTP, also known as fortilin, a multifunctional protein highly conserved in eukaryotes (Nayak et al., 2010) that plays essential roles in cell growth (Gachet et al., 1999), cell cycle progression (Cans et al., 2003), and anti-apoptotic activity (Liu et al., 2005). TCTP gene expression decreases in P. monodon infected with a high WSSV burden (Bangrak et al., 2004). Furthermore, fortilin plays an essential role in response to Vibrio harveyi in P. monodon through its participation in the mechanisms of cell death (apoptosis) (Nayak et al., 2010). In addition, TCTP plays an important role in the immune response to WSSV in gills of P. vannamei (Wu et al., 2013). In this work, the expression of TCTP in hemocytes of shrimp fed with A. vera decreased significantly after 6 h. Therefore, it is possible that A. vera affects cellular processes in shrimp hemocytes that are very important in WSSV (Bangrak et al., 2004) and Vibrio (Nayak et al., 2010) infections, such as cell growth (Gnanasekar et al., 2009) and/or cell death pathway (Bangrak et al., 2004).
During the phagocytosis process carried out by hemocytes, reactive oxygen species (ROS) are produced, such as superoxide anion (O2-), which are microbicides (Campa-Córdova et al., 2005; Medina-Beltrán et al., 2012; Peraza-Gómez et al., 2014). SOD production in crustaceans responds to pathogen infection, as observed in P. monodon challenged with V. harveyi, where the MnSOD gene is up-regulated in hemocytes. The authors found that the modulation of SOD gene expression is related to the presence of pathogens and defense processes (Nayak et al., 2010). Regarding A. vera's effect, in this work, SOD gene expression was significantly higher at 24, 48, and 72 h as compared to the initial hours (0, 6, and 12 h). Similar results in SOD gene expression were found in P. vannamei, treated with the polysaccharide extract of the root of Panax ginseng (0.4 g kg diet−1) (Liu et al., 2011), P. monodon, treated with sodium alginate (2.0 g kg−1) (Liu et al., 2006), and P. vannamei, fed with the extract of Rubus coreanus (0.25 and 0.5%) (Subramanian et al., 2013). Results found in this work suggest that A. vera, administered orally, can enhance the release of the superoxide anion free radical in hemocytes by increasing phagocytosis due to immunostimulant substances (acemannans, glucomannans, aloctin A, and aloe emodin) (Hu et al., 2003; Akev et al., 2015).
Antimicrobial peptides (AMP) have a crucial role in innate immunity, which is evolutionarily conserved from invertebrates to vertebrates. Gene expression of these proteins appears to be induced only by microbial infections (Destoumieux et al., 2000; Gueguen et al., 2006); however, in the response induced by shrimp injury, AMP act as a pro-inflammatory cytokine, resulting in rapid gene expression (Li & Song, 2010). Penaeidins are effective against Gram-positive bacteria but not against Gram-negative (Destoumieux et al., 1997, 1999). However, in P. vannamei challenged with V. harveyi, penaeidin4 was significantly up-regulated at 18, 24, 36, and 48 h postinfection (Wang et al., 2010). Similarly, the expression of the gene fein-penaeidin in Fenneropenaeus indicus increased at 6, 12, 24, 36, and 48 h after infection with V. parahaemolyticus injected at a concentration of 6×106 CFU (Vaseeharan et al., 2012). In this work, penaeidin4 gene expression increased significantly at 6 h, which proves its early expression in hemocytes due to immunostimulant substances of A. vera such as acemannans, glucomannans, aloctin A, and aloe emodin (Hu et al., 2003; Akev et al., 2015).
Heat shock proteins, such as Hsp70, are accessory proteins that play an important role in the immune response as chaperones and as inducers of proinflammatory cytokines secretion (Spagnolo et al., 2007). Chaperones help in defense against microbial infections by sending signals to the immune system in the phagocytosis process and by stimulating the production of antibodies and T lymphocytes in mammals (Valpuesta et al., 2002). In penaeid shrimp (invertebrates), Hsp70 and Hsp10 have been reported in P. vannamei and Hsp82, Hsp29, and Hsp28 in P. setiferus (Gross et al., 2001). Hsp70 is present at low levels in many cells and is induced by stress, regardless of their cell cycle stage. Furthermore, Hsp70 can be highly induced in infections caused by bacteria or viruses (Eisenhut, 2008; Espigares et al., 2006) like in P. vannamei challenged with TSV (Taura syndrome virus) where Hsp70 gene expression was associated with resistance against TSV (Zeng et al., 2008). In this work, the expression of the Hsp70 gene in the hepatopancreas was significantly increased after 48 h. It is possible that the increase in the gene expression was due to some adverse effects (stress) of plant molecules such as tannins (antinutritional factors) or aloin (laxative in humans) (Domínguez-Fernández et al., 2012; Gilani et al., 2012), which affect the hepatopancreas function when these molecules are in excess in the diet.
In previous work, our research group demonstrated the increase in survival of P. vannamei fed with A. vera and challenged with V. parahaemolyticus. However, this is the first report showing the effect of A. vera on the modulation of shrimp immune response. Further research is needed about the use of A. vera as a prophylactic treatment against V. parahaemolyticus in shrimp farms.
