SciELO - Scientific Electronic Library Online

 
vol.46 número3Primer reporte de infección causada por el protozoario Ophryocystis elektroscirrha McLaughlin y Myers (Neogregarinida: Ophryocystidae) en la mariposa monarca Danaus plexippus megalippe f. portoricensis A. Clark (Lepidoptera: Nymphalidae) en Puerto RicoMariposas de la familia Pieridae (Lepidoptera: Papilionoidea) de la cuenca de río Frío, nororiente de los Andes de Santander, Colombia índice de autoresíndice de materiabúsqueda de artículos
Home Pagelista alfabética de revistas  

Servicios Personalizados

Revista

Articulo

Indicadores

Links relacionados

  • En proceso de indezaciónCitado por Google
  • No hay articulos similaresSimilares en SciELO
  • En proceso de indezaciónSimilares en Google

Compartir


Revista chilena de entomología

versión impresa ISSN 0034-740Xversión On-line ISSN 0718-8994

Rev. chil. entomol. vol.46 no.3 Santiago set. 2020

http://dx.doi.org/10.35249/rche.46.3.20.19 

Research Article

Investigation of the triatomine (Hemiptera: Triatominae) fauna and its infection by Trypanosoma cruzi Chagas (Kinetoplastida: Trypanosomatidae), in an area with an outbreak of Chagas disease in the Brazilian South-Western Amazon

Investigación de la fauna triatomina (Hemiptera: Triatominae) y su infección por Trypanosoma cruzi Chagas (Kinetoplastida: Trypanosomatidae), en un área con un brote de enfermedad de Chagas en la Amazonía sudoccidental brasileña

Fernanda Portela Madeira1  2 

Adila Costa De Jesus1  2 

Madson Huilber Da Silva Moraes1  2 

Weverton Páscoa Do Livramento2 

Maria Lidiane Araújo Oliveira2 

Jader De Oliveira3  4 

João Aristeu Da Rosa3  4 

Luís Marcelo Aranha Camargo1  5  6  7  8 

Dionatas Ulises De Oliveira Meneguetti1  9  * 

Paulo Sérgio Bernarde1  2 

1Stricto Sensu Graduate Program in Health Sciences in the Western Amazon, Federal University of Acre, Rio Branco, Acre, Brazil.

2Multidisciplinary Center, Federal University of Acre, Campus Floresta, Cruzeiro do Sul, Acre, Brazil.

3Department of Biological Sciences, School of Pharmaceutical Sciences, Paulista State University Júlio de Mesquita Filho (UNESP), Araraquara, São Paulo, Brazil.

4Stricto Sensu Graduate Program in Biosciences and Biotechnology, Paulista State University Júlio de Mesquita Filho (UNESP), Araraquara, São Paulo, Brazil.

5Institute of Biomedical Sciences -5, University of São Paulo, Monte Negro, Rondônia, Brazil.

6Department of Medicine, São Lucas University Center, Porto Velho, Rondônia, Brazil.

7Research Center for Tropical Medicine of Rondônia-CEPEM / SESAU, Rondônia, Brazil.

8INCT/CNPq EpiAmo-Rondônia, Rondônia, Brazil

9College of Application, Federal University of Acre, Rio Branco, Acre, Brazil.

Abstract

The present study aims to describe the occurrence of triatomines and their infection rate by Trypanosoma cruzi, in an area of Chagas disease outbreak in Rodrigues Alves municipality, Acre state, Brazil. Collections were performed by passive search (capture of specimens by local people) and dissection of palm trees (Attalea butyracea and Mauritia flexuosa). Thirty two triatomines belonging to four species grouped into two genera (Rhodnius and Eratyrus) had T. cruzi infection rate of 15.6%. Only in A. butyracea triatomines were captured. The passive search was the most effective method for collection. The Nova Cintra triatomine fauna comprises four species and it is important to carry out future studies to understand the biology of these triatomines.

Key words: Chagas disease vectors; Trypanosomatids; medical entomology; Chagas disease and the Amazon

Resumen

El presente estudio tiene como objetivo describir la aparición de triatominos y la infección causada por Trypanosoma cruzi, en un área de brote de la enfermedad de Chagas en el municipio de Rodrigues Alves, estado de Acre, Brasil. Las recolecciones se realizaron mediante búsqueda pasiva y disección en palmeras (Attalea butyracea y Mauritia flexuosa). Treinta y dos triatominos pertenecientes a cuatro especies agrupadas en dos géneros (Rhodnius y Eratyrus) tenían una tasa de infección por T. cruzi del 15,6%. Solo en A. butyracea se capturaron triatominos. La búsqueda pasiva fue el método más efectivo para la recolección. La fauna triatomina de Nova Cintra comprende cuatro especies, es importante realizar futuros estudios para comprender su biología.

Palabras clave: Vectores de la enfermedad de chagas; trypanosomatids; entomología médica; enfermedad de Chagas y la Amazonía

Introduction

Chagas' disease (CD), also known as American trypanosomiasis, is an infectious disease whose etiologic agent is the protozoan Trypanosoma cruzi Chagas, 1909 (Kinetoplastida: Trypanosomatidae) (Chagas 1909; Castro et al. 2017) and the vectors are blood-sucking hemipteran insects, belonging to the Hemiptera order, Reduviidae family and Triatominae subfamily (Barbosa et al. 2015).

Although the Amazon region was excluded as a region of occurrence of CD until the mid-1970s, it has recently aroused the concern of the authorities in public health because of growing reports of this disease, which is still considered to be emerging in the region (Barbosa et al. 2015; Santana et al. 2019). Most of these cases are of transmission through contaminated foods, mainly regional drinks, such as the juice of “açaí” (Euterpe precatoria Mart.) (Barbosa et al. 2015). In addition to oral transmission, the possibility of vector transmission is another concern, given the existence of more than 30 species of triatomines described for the Amazon region (Castro et al. 2018).

In the Brazilian Amazon, Acre is considered one of the states with the greatest diversity of triatomines, with 11 species reported, all of them already found naturally infected with trypanosomatids (Oliveira et al. 2019). Although the first case of CD in the state of Acre was recorded in the 1980s (Barata et al. 1988), it was the outbreaks from 2016 onwards that raised the concern about the disease, given the increase in notifications and its intrinsic relationship with the consumption of contaminated food. An example is the outbreak that occurred in the municipality of Rodrigues Alves in 2016 (Oliveira et al. 2018). Since there are no studies on the vector species occurring in this region, studies are needed to increase the knowledge about this subject and thus raise the community's awareness of prophylactic measures, serving as a tool for guiding health surveillance in the establishment of strategies for combating new outbreaks. Thus, this study is aimed at investigating the occurrence of triatomines and their infection by T. cruzi in an area of CD outbreak in the municipality of Rodrigues Alves, Acre, Brazil, where an outbreak was reported with five cases confirmed during February 2016, all of them apparently caused by oral transmission, probably by consumption of “açaí” juice contaminated with feces from triatomines (Oliveira et al. 2018).

Material and Methods

The collections were made from August 2017 to December 2018, at the Nova Cintra Settlement Project (S 7°48,808' and W 72°40,480'), located in Rodrigues Alves, Acre, about 12 km away the urban area of the municipality (Fig. 1).

The collections were made with a permanent license (license n° 52260-1) issued by the Brazilian Institute for the Environment and Renewable Natural Resources (Instituto Brasileiro de Meio Ambiente e dos Recursos Naturais Renováveis - IBAMA). The technique used to collect triatomines consisted of passive search in households and active search through the dissection of two palm species: Mauritia flexuosa (“buriti”) and Attalea butyracea (“jaci”). The bracts of two palm trees, one M. flexuosa and one A. butyracea, were dissected in each quarterly collection, totaling eight palm trees collected, 4 of each species.

The bracts were dissected using a chainsaw. They were gradually removed starting from the lower ones to the palm crown, with the specimens being manually collected, separated, and stored according to their stage of development.

The passive search performed in households consisted of distributing collection vials containing folded paper to community residents, along with the presentation of the morphological characteristics of the triatomines to the adults responsible for the households using printed images and specimens collected in their community.

Figure 1 Geographic location of the study area. A) State of Acre; B) South America; C) Nova Cintra. 

The collected specimens were identified based on the external morphological characteristics described by Lent & Wygodzinsky (1979), Rosa et al. (2012) and Galvão (2014). The species belonging to the genus Rhodnius Stål, 1859 had their genitalia analyzed for confirming the species (Lent and Wygodzinsky 1979; Rosa et al. 2012, 2014; Galvão 2014). The natural infection of triatomines by trypanosomatids was analyzed using feces obtained through compression of the insect's abdomen, followed by maceration and dilution in 0.9% saline solution. The resulting sample was mounted on a slide and examined using an optical microscope under 400-fold magnification Staining was performed with triarylmethane 0.1%, xanthene 0.1%, and thiazines 0.1%. Optical microscopy at 1000x magnification was used for examination.

The remaining portion of the material used for microscopy was inserted into microtubes containing absolute alcohol for biomolecular identification, which followed the protocol described by Fernandes et al. (2001), with the extraction of trypanosomatid DNA using the Qiagen DNA extraction kit ® . Then, Polymerase Chain Reaction (PCR) technique was performed to amplify part of the non-transcribed spacer of the mini-exon gene that varied, according to the species T. cruzi (TC I and II) and T. rangeli. In the method, the generated fragments varied between 100 and 250 base pairs, and oligonucleotides primers with the following sequences were used: TCI: (200 bp) (5'ACACTTTCTGGCGCTGATCG); TCII: (250 bp) (5'TTGCTCGCACACTCG GCTGCAT); Z3: (150 bp) (5'CCGCGCACAACCCCTATAAAAATG); TR: (100 bp) (5'CCTATTGTGATCCCCATCTTCG); EXON: (5'TACCAATATAGTACAGAACTG).

Each reaction required 100 ppmol of each primer, 150 μM dNTPs, in 10 mM Tris-HCl buffer (pH 8.3), 1.5 mM MgCl2, 25 mM KCl, 0.1 mg/mL of bovine albumin, 2.5 U of TaqDNA Polymerase. Subsequently, 10 ng of the genomic DNA sample was added, resulting in a final volume of 50 μL with Type 1 water (Fernandes et al. 2001). The reaction started the cycle at 95°C for 5 minutes, followed by 34 cycles of 30 seconds at 94°C, 30 seconds at 55°C, and 30 seconds at 72°C, with a final extension of 10 minutes at 72°C. The reference strains used as control were: TC1 X10 Clone 1, TC2 Cepa Y, Z3 Esmeraldo Clone 1, and T. rangeli R1625. The amplified products were subjected to 2% agarose gel electrophoresis at 100 volts for 1 hour. After electrophoresis, DNA was revealed with ethidium bromide and visualized under ultraviolet light (Fernandes et al. 2001).

Results

Thirty-two triatomines belonging to four species grouped into two genera were collected throughout the study (Table 1). Infection of these triatomines by T. cruzi is also shown in table 1. There were no triatomines infected by T. rangeli.

Discussion

The low occurrence of triatomines collected from palm trees differs from other studies conducted in the Amazon region (Meneguetti et al. 2012) and may be related to the characteristics of the environment studied, with a lower density of palm trees of the genus Attalea. Data showing the absence of triatomines in M. flexuosa of the region differ from studies conducted with the same species of palm in another biome (Gurgel-Gonçalves et al. 2012), where species of triatominae that do not yet occur in the region of Juruá were collected.

The natural infection rate for T. cruzi was 15.6%, a percentage lower than that found in other studies conducted in the Amazon region, with rates of 23.7% (Massaro et al. 2008) and 35.6% (Meneguetti et al. 2012).

The species R. montenegrensisRosa et al. (2012), represented 56% of the total of collected triatomines and 64% of those found within households. The higher occurrence of R. montenegrensis in the present study further strengthens the hypothesis of underreporting of the occurrence of triatomines of this species in the Amazon region, as it was only described in 2012 in the municipality of Monte Negro, Rondônia (Rosa et al. 2012), having been confirmed by karyotype and molecular analysis (Alevi et al. 2015; Carvalho et al. 2017). However, it is believed that its morphological similarity with R. robustus Larrousse, 1927, may have caused some errors in taxonomic study identities before 2012, as well as in subsequent identification using only external morphological characteristics.

The occurrence of R. montenegrensis, in this and other studies conducted in the state of Acre (Meneguetti et al. 2015; Ribeiro et al. 2019), added to the evidence of its infection by T. cruzi (Bilheiro et al. 2018) and T. rangeli (Meneguetti et al. 2015) and its occurrence in rural households (Meneguetti et al. 2015) and urban environment (Ribeiro et al. 2019), shows the potential of this species for transmission of CD.

The second highest most prevalent triatomine in this study was R. pictipes Stål, 1872, representing 25% of the total of triatomines collected, two of which were positive for T. cruzi. Both were collected from palm trees of the species A. butyraceae, which is considered a natural ecotope of this species in the wild (Galvão 2014). The specimens collected from palm trees were positive for T. cruzi. Similar data to this were found by other studies conducted in the state of Acre, where R. pictipes Stål, 1872 was collected in palm trees (Ramos et al. 2018) and households (Ribeiro et al. 2019), finding infection by T. cruzi in both environments. R. pictipes may also be associated with the first case of CD in the state of Amazonas (et al. 2009), having a high prevalence both in wild and households in the city of Manaus, where 73.9% of the total specimens were found (Fé et al. 2009).

Rhodnius stali Lent, Jurberg & Galvão, 1993, represented 12.5% of the total of triatomines, with a record of infection by T. cruzi. There are confirmed reports of domiciliation in Bolivia, held as the most likely responsible for the transmission of T. cruzi in indigenous communities in Alto Beni (Matias et al. 2003). It occurs in the state of Acre (Meneguetti et al. 2016) and is also susceptible to infection by T. rangeli, which makes the differential diagnosis of trypanosomatids difficult (Castro et al. 2017), which indicate that mixed infections may be occurring in the state.

Table 1 Triatomine species collected and positivity for T. cruzi in the Nova Cintra, Acre, Brazil. 

Species Collection Method/ Amount Positives for T. cruzi
P (0) -
PD (0) -
Rhodnius montenegrensisRosa et al., 2012 I (18) 2 (11%)
TR (0) -
T (18) 2 (11%)
P (2) 2 (100%
PD (0) -
Rhodnius pictipes Stål, 1872 I (6) -
TR (0) -
T (8) 2 (25%)
P (0) 0
PD (0) -
Rhodnius stali Lent, Jurberg & Galvão, 1993 I (4) 1 (25%)
TR (0) -
T (4) 1 (25%)
P (1) 0 (0%)
PD (0) -
Rhodnius sp.* I (0) -
TR (0) -
T (1) 0 (0%)
P (1) 0 (0%)
PD (0) -
Eratyrus mucronatus Stål, 1859 I (0) -
TR (0) -
T (1) -
Total 32 5 (15,6%)

* Species whose identification was made impossible by the stage of development (nymph 1). Legend: P: Palm tree. PD: Peridomicile, I: Intradomicile, TR: Trap and T: Total.

In addition to species belonging to the genus Rhodnius, a nymph of fifth stage, belonging to the genus Eratyrus Stål, 1859 was collected during dissection in A. butyracea and identified as E. mucronatus Stål, 1859. Although this species, which is a wild vector of CD, is considered to be of lesser epidemiological importance (Lent and Wygodzinsky 1979), it can quickly adapt to artificial ecotopes, when their natural habitats are destroyed by anthropic actions (Meneguetti et al. 2011) this species naturally infected by T. cruzi, also being reported in households in countries such as Bolivia, Peru, and Venezuela (Meneguetti et al. 2011). E. mucronatus was also observed in households in the state of Acre, where an Attalea palm tree was observed in the vicinity of the residence (Obara et al. 2013).

The passive search considered that the most effective method of sampling in the region was carried out by the research team and the inhabitants who identified the insect during the night. However, the invasion of triatomines in homes does not characterize domiciliation and can occur due to the chemical and luminous attraction within the households (Galvão 2014). The number of reports of triatomine intrusion is increasing among households in urban and peri-urban areas in the Amazon (et al. 2009; Ribeiro et al. 2019), with only one report of domiciliation in the entire region (Ricardo-Silva et al. 2016). Therefore, the invasion of these vectors may also be due to the destruction of the nearby forest areas, causing wild species to be closer to residential areas.

The species of triatomines occurring in Nova Cintra are grouped into two genera (Rhodnius and Eratyrus), with a natural infection rate for T. cruzi of 15.6% and with low infestation rate in palm trees. The method for raising the awareness of the vector by the community residents was effective for the collection of adult triatomines that invade the residences at night and to guide measures to prevent the disease in the community.

It is important to conduct research to evaluate triatomines and their infection in the region to understand ecological aspects and possible changes in the current dynamics of CD transmission, thus preventing the occurrence of new outbreaks in the region.

Acknowledgements

The authors would like to thank the Research Support Foundation of the State of Acre (FAPAC), the Dean of Research and Graduate Studies at the Federal University of Acre (UFAC) and the Coordination for the Improvement of Higher Education Personnel - Brazil (CAPES) - Finance Code 001.

Literature Cited

Carvalho, E.O., Rosa, J.A., Carvalho, A.A., Chaves, H.C., Souza, E.A., Ostermayer, A.L. and Camargo, L.M.A. (2011) Study on Chagas disease occurrence in the municipality of Monte Negro, State of Rondônia, Brazilian Amazon. Revista da Sociedade Brasileira de Medicina Tropical, 44(6): 703-707. [ Links ]

Alevi, K.C.C., Ravazi, A., Mendonça, V.J. and Rosa, J.A. (2015) Karyotype of Rhodnius montenegrensis (Hemiptera, Triatominae). Genetics and Molecular Research, 14: 222-226. [ Links ]

Angulo, V.M., Esteban, L. and Luna, K.P. (2012) Attalea butyracea próximas a las viviendas como posible fuente de infestación domiciliaria por Rhodnius prolixus (Hemiptera: Reduviidae) en los Llanos Orientales de Colombia. Biomédica, 32(2): 277-285. [ Links ]

Barata, J.M., Rocha, R.M., Rodrigues, V.L. and Ferraz- Filho, A.N. (1988) Primeiro caso autóctone de tripanossomíase americana do Estado do Acre (Brasil) e sua correlação com as cepas isoladas do caso humano e de triatomíneos silvestres da área. Revista de Saude Publica, 22(5): 401-410. [ Links ]

Barbosa, M.G.V., Ferreira, J.M.B., Arcanjo, A.R.L., Santana, R.A.G., Magalhães, L.K.C., Magalhães, L.K.C., Mota, D.T., Fé, N.F., Monteiro, W.M., Silveira, H. and Guerra, J.A.O. (2015) Chagas disease in the State of Amazonas: history, epidemiological evolution, risks of endemicity and future perspectives. Revista da Sociedade Brasileira de Medicina Tropical, 48: 27-33. [ Links ]

Bilheiro, A.B., Rosa, J.A., Oliveira, J., Belintani, T., Fontes, G., Medeiros, J.F., Meneguetti, D.U.O. and Camargo, L.M.A. (2018) First Report of Natural Infection with Trypanosoma cruzi. Vector-Borne and Zoonotic Diseases, 20(20): 1-6. [ Links ]

Carvalho, D.B.D., Congrains, C., Chahad-Ehlers, S., Pinotti, H., Brito, R.A. and Rosa, J.A. (2017) Differential transcriptome analysis supports Rhodnius montenegrensis and Rhodnius robustus (Hemiptera, Reduviidae, Triatominae) as distinct species. PLoS ONE, 12(4): 1-16. [ Links ]

Castro, G.V.S., Ribeiro, M.A.L., Ramos, L.J., Oliveira, J., Rosa, J.A., Camargo, L.M.A. and Meneguetti, D.U.O. (2017) Rhodnius stali: new vector infected by Trypanosoma rangeli (Kinetoplastida, Trypanosomatidae ). Revista da Sociedade Brasileira de Medicina Tropical, 50(6): 829-832. [ Links ]

Castro, M.A.L.R., Castro, G.V.S., Souza, J.L., Souza, C.R., Ramos, L.J., Oliveira, J., Rosa, J.A., Camargo, L.M.A and Meneguetti, D.U.O. (2018) First report of Panstrongylus megistus (Hemiptera, Reduviidae, Triatominae) in the State of Acre and Rondônia, Amazon, Brazil. Acta Tropica, 182: 158-160. [ Links ]

Fé, N.F., Magalhães, L.K., Fé, F.A., Arakian, S.K., Monteiro, W.M. and Barbosa, M.G.B.V. (2009) Ocorrência de triatomíneos em ambientes silvestres e domiciliares do município de Manaus , Estado do Amazonas Occurrences of triatomines in wild and domestic environments in the municipality of Manaus, State of Amazonas. Revista da Sociedade Brasileira de Medicina Tropical, 42(6): 642-646. [ Links ]

Fernandes, O., Santos, S.S., Cupolillo, E., Mendonca, B., Derre, R., Junqueira, A.C.V., Santos, L.C., Sturm, N.R., Naiff, R.D., Barret, T.V., Campbell, D.A. and Coura, J.R. (2001) A mini-exon multiplex polymerase chain reaction to distinguish the major groups of Trypanosoma cruzi and T-rangeli in the Brazilian Amazon. Transactions of the Royal Society of Tropical Medicine and Hygiene, 95: 97-99. [ Links ]

Galvão, C. (2014) Vetores da Doença de Chagas no Brasil (SciELO Boo). Curitiba: 2014. https://doi.org/10.7476/9788598203096. [ Links ]

Gurgel-Gonçalves, R., Cura, C., Schijman, A.G. and Cuba, A.C.C. (2012) Infestation of Mauritia flexuosa palms by triatomines (Hemiptera: Reduviidae), vectors of Trypanosoma cruzi and Trypanosoma rangeli in the Brazilian savanna. Acta Tropica, 121(2): 105-111. [ Links ]

Lent, H. and Wygodzinsky, P. (1979) Revision of the Triatominae (Hemiptera, Reduviidae), and their significance as vectors of Chagas disease. Bulletin of the American Museum of Natural History, 163: 123-520. [ Links ]

Massaro, D.C., Rezende, D.S. and Camargo, L.M.A. (2008) Estudo da fauna de triatomíneos e da ocorrência de doença de Chagas em Monte Negro, Rondônia, Brasil Study of the triatomine fauna and occurrence of Chagas disease in. Revista Brasileira de Epidemiologia, 11(2): 228-240. [ Links ]

Matias, A., Riva, J.D., Martinez, E., Torrez, M. and Dujardin, J.P. (2003) Domiciliation process of Rhodnius stali ( Hemiptera : Reduviidae ) in Alto Beni , La Paz , Bolivia. Tropical Medicine and Internacional Health, 8(3): 264-268. [ Links ]

Meneguetti, D.U.O., Trevisan, O., Camargo, L.M.A. and Rosa, R.M. (2012) Natural infection of triatomines (Hemiptera : Reduviidae ) by trypanosomatids in two different environments in the municipality of Ouro Preto do Oeste , State of Rondônia, Brazil. Revista da Sociedade Brasileira de Medicina Tropical, 45(3): 395-398. [ Links ]

Meneguetti, D.U.O., Trevisan, O., Rosa, R.M. and Camargo, L.M.A. (2011) First report of Eratyrus mucronatus, Stal, 1859 (Hemiptera, Reduviidae, Triatominae), in the State of Rondônia, Brazil. Revista da Sociedade Brasileira de Medicina Tropical, 44(4): 511-512. [ Links ]

Meneguetti, D.U.O., Castro, G.V.S., Castro, M.A.L.R., Souza, J.L., Oliveira, J., Rosa, J.A. and Camargo, L.M.A. (2016) First report of Rhodnius stali (Hemiptera, reduviidae, triatominae) in the state of acre and in the Brazilian Amazon. Revista da Sociedade Brasileira de Medicina Tropical, 49(3): 365-368. [ Links ]

Meneguetti, D.U.O., Tojal, S.D., Miranda, P.R.M., Rosa, J.A. and Camargo, L.M.A. (2015) First report of Rhodnius montenegrensis in the State of Acre, Brazil. Revista da Sociedade Brasileira de Medicina Tropical, 48: 471-473. [ Links ]

Obara, M.T., Cardoso, A.S., Pinto, M.C.G., Souza, C.R., Silva, R.A. and Gurgel-Gonçalves, R. (2013) Eratyrus mucronatus Stål, 1859 (Hemiptera: Reduviidae: Triatominae): First report in the State of Acre, Brazil, and updated geographic distribution in South America. Check List, 9(4): 851-854. [ Links ]

Oliveira, A.S., Ribeiro, M.A.L., Castro, G.V.S., Brilhante, N.A., Camargo, L.M.A. and Meneguetti, D.U.O. (2019) Confirmation of the occurrence of Panstrongylus rufotuberculatus (Champion, 1899) in the state of acre, western amazon. Revista da Sociedade Brasileira de Medicina Tropical, 52: 10-12. [ Links ]

Oliveira, G.F., Ribeiro, M.A.L., Castro, G.V.S., Menezes, A.L.R., Lima, R.A., Silva, R.P.M. and Meneguetti, D.U.O. (2018) Retrospective study of the epidemiological overview of the transmission of Chagas disease in the State of Acre, South-Western Amazonia, from 2009 to 2016. Journal of Human Growth and Development, 28(3): 329-336. [ Links ]

Ramos, L.J., Castro, G.V.S., Souza, J.L., Oliveira, J., Rosa, J.A., Camargo, L.M.A., Cunha, R.M. and Meneguetti, D.U.O. (2018) First report of Rhodnius neglectus (Hemiptera, Reduviidae, Triatominae) from the state of acre, Brazil, and the Brazilian western Amazon region. Revista da Sociedade Brasileira de Medicina Tropical, 51(2): 212-214. [ Links ]

Ribeiro, M.A.L., Castro, G.V.S., Souza, J.L., Rosa, J.A., Camargo, L.M.A. and Meneguetti, D.U.O. (2019) Occurrence of triatomines in an urban residential complex in the municipality of Rio Branco, Acre , South-Western Amazon. Revista da Sociedade Brasileira de Medicina Tropical, 52: 2016-2019. [ Links ]

Ricardo-Silva, A., Cristina, T., Gonçalves, M., Luitgards-Moura, J.F., Lopes, C.M., Pedrosa, S., Bastos, A. Q., Vargas, N.C. and Rosa-Freitas, M.G. (2016) Triatoma maculata colonises urban domicilies in Boa Vista, Roraima, Brazil. Memórias do Instituto Oswaldo Cruz, 111(11): 703-706. [ Links ]

Rosa, J.A., Rocha, C.S., Gardim, S., Pinto, M.C., Mendonça, V.J., Ferreira Filho, J.C.R., Carvalho, E.O.C., Camargo, L.MA., Oliveira, J., Nascimento, J.D., Cilense, M. and Almeida, C.E. (2012) Description of Rhodnius montenegrensis n. sp. (Hemiptera: Reduviidae: Triatominae) from the state of Rondônia, Brazil. Zootaxa, 3478: 62-76. [ Links ]

Rosa, J.A., Mendonça, V.J., Gardim, S., Carvalho, D.B., Oliveira Nascimento, J.D., Pinotti, H., Pinto, M.C., Cilense, M., Galvão, C. and Barata, M.J.S. (2014) Study of the external female genitalia of 14 Rhodnius species (Hemiptera , Reduviidae, Triatominae) using scanning electron microscopy. Parasite and Vectors, 7(17): 1-10. [ Links ]

Santana, R.A.G., Guerra, M.G.V.B., Ortiz, J.V., Oliveira, M., Ferreira, L.S., Souza, K.R., Tavares, I.C., Morais, R.F., Silva, G.A.V., Melo, G.C., Vergel, G.M., Albuquerque, B.C., Arcanjo, A.R.L., Monteiro, W. M., Ferreira, J.M.B.B., Lacerda, M.V.G., Silveira, H. and Guerra, J.A.O. (2019) Oral Transmission of Trypanosoma cruzi, Brazilian Amazon. Emerging Infectious Diseases, 25: 25-28. [ Links ]

Received: August 14, 2020; Accepted: September 14, 2020

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License