SciELO - Scientific Electronic Library Online

 
vol.16 número3Modulation of antioxidant enzymes by salicylic acid in arsenic exposed Glycine max L.Structural characterization of a compacted alfisol under different tillage systems índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Journal

Artigo

Indicadores

Links relacionados

  • Em processo de indexaçãoCitado por Google
  • Não possue artigos similaresSimilares em SciELO
  • Em processo de indexaçãoSimilares em Google

Compartilhar


Journal of soil science and plant nutrition

versão On-line ISSN 0718-9516

J. Soil Sci. Plant Nutr. vol.16 no.3 Temuco set. 2016

http://dx.doi.org/10.4067/S0718-95162016005000049 

 

Abundance of denitrifying genes and microbial community structure in volcanic soils

 

A.M. Carvajal1*, R.A. Vargas1, M. Alfaro1

 

1Instituto de Investigaciones Agropecuarias, Laboratorio de Biotecnología. INIA Remehue, Carretera Panamericana Sur km 8 Norte, Osorno, Chile.

*Corresponding author: andres.carvajal@inia.cl

 


 

Abstract

Nitrous oxide (N2O) is a potent greenhouse gas produced during denitrification, a process that includes several genes coding enzymes responsible for nitrogen (N) forms transformations. In volcanic ash soils of southern Chile, fertilization had increased over the last 10 years with implications for N2O emissions. Despite this, little is still known about potential denitrification and the presence of denitrifying genes. In this study we report the abundance of denitrifying genes and a basal characterization of microbial communities in five volcanic ash soils with different levels of organic matter. The denitrifying genes determination showed that nosZI predominated over nirK and nirS in all soils suggesting a complete denitrification pathway, which would explain low N2O losses in such soils. Estimation of total microorganisms studies using 16S and 18S rRNA showed that in these soils bacteria (109) was most abundant over archaea and fungi (107; p<0.05). Sequences of DNA obtained by denaturant gradient gel electrophoresis (DGGE) indicated that Firmicutes, Acidobacteria and Proteobacteria are the main bacterial classes represented in Andisoils (33, 28 and 23%, respectively) but with a lower diversity. More detailed studies about denitrifiers, gene-activity relationship and N2O emissions are required.

Keywords : Volcanic soils, denitrification, nitrous oxide, denitrifying genes, microbial diversity

 


 

1. Introduction

Agricultural soils are the main source of nitrous oxide (N2O) worldwide. Almost 300 times more influential that carbon dioxide (CO2), N2O contributes 10% to climate change each year and it is involved in the loss of the ozone layer (Thompson et al., 2012). This gas is produced in the nitrogen (N) cycle, one of the major biogeochemical processes that is taking place in the biosphere. The cycle consists of two steps, nitrification and denitrification. The latter is an anaerobic respiration process involving a sequential and modular reduction of N species from nitrate (NO3-) or nitrite (NO2-) to nitric oxide (NO), nitrous oxide (N2O) and nitrogen gas (N2). Each one of these reductive steps is catalyzed by enzyme complexes: Nar, Nir, Nor and N2or, respectively, which in turn are encoded by narG and napA genes for Nar, nirK and nirS for Nir, norB and qnorB for Nor, and nosZ for the complex N2 or (Philippot et al., 2007). The description of this process has been mainly described in different bacterial communities, but its role in Archaea and Fungi domains it has only been recently studied (Maeda et al., 2015).

In Chile, agriculture is mainly carried out in the central and southern region of the country on volcanic ash soils (Andisoils, Alfisoils and Ultisoils) with a varied pattern of physicochemical properties including soil organic matter (SOM) content (Escudey et al., 2001). In Andisoils, Alfaro and Salazar (2008) have reported higher N losses as NO3 whereas Vistoso et al. (2012) showed lower N2O emissions after N application, suggesting that denitrification and N2O emissions are limited and likely to be carried out completely, favoring N2 formation. A preliminary study of the abundance of genes linked to the denitrification process showed that in two Andisoils with high SOM, the presence of bacterial nosZ gene was abundant, supporting the idea that in these soils denitrification was carried out comprehensively (Cardenas et al., 2013). However, no information is available in relation to denitrifying genes in others soil types, neither the abundance and microbial composition related to denitrification in other domains.

The objectives of this study were i) to quantify the abundance of bacterial denitrifying genes (nirK, nirS and nosZI) in volcanic ash soils, and ii) to evaluate the bacterial diversity and its relative abundance to archaea and fungi domains in these soils.

2. Materials and Methods

2.1. Experimental sites and soil sampling

Five soil series were selected providing a range of SOM content: Collinco (36°43,S, 71°54,W), Arrayán (36°32,S, 71°55,W), Cudico (40°39,S, 73°21,W), Osorno (40°31,S, 73°02,W) and Nueva Braunau (41°25,S, 73°24,W), with SOM contents of 4, 16, 15, 21 and 45%, respectively (Table 1). Soil samples (0 to 10 cm depth, n=3) were taken between august 2013 and march 2014 from permanent grassland sites with no recent history of N fertilizer application or grazing, and transported to INIA Remehue (40°35,S, 73°12,W), where they were thoroughly mixed, sieved to 2mm and stored at -80 °C. The physicochemical analysis of soils (Table 1) was performed according to Sadzawka et al. (2006) and Lobos Ortega et al. (2016).

Table 1. Main physicochemical soil characteristics (0-10 cm depth; n=3).

1Classification according to CIREN (2003); SOM: soil organic matter; C/N: carbon to nitrogen ratio; N, nitrogen; P, phosphorus; Al sat, aluminum saturation; Cu, Cu2+ concentration.

2.2. DNA extraction

Total DNA was extracted from 0.3 g of soil from each series using the PowerSoil™ DNA Isolation Kit (MO BIO Laboratories, Inc., USA) and according to the manufacturer,s instruction. The DNA was quantified by spectrophotometry using an Infinite M200 NanoQuant microplate reader (Tecan Trading AG; Switzerland) and its quality was evaluated by agarose gel electrophoresis in TAE 1x buffer stained wuth GelRed (Biotium, USA) as mentioned in Armas-Ricard et al (2016). The DNA samples were stored in aliquots at -80 °C until amplification.

2.3. Quantitative PCR

Amplification of gene fragments was performed on a Rotor-Gene 6000 (Qiagen, Germany) using published primers (Table 2). Three replicates of each soil were used and run in triplicate. All amplifications were performed using the SensiFAST HRM Kit (Bioline Reagents Ltd.; UK), each reaction containing a final concentration of 1X SensiFAST HRM Mix, 400 nM Forward primer, 400 nM Reverse primer, 10 ng of DNA template and DNase-free water in 20 uL of reaction. Each amplification included a negative control without DNA (NTC). For denitrifying genes, the copy number was normalized to account for soil moisture and to bacterial 16S rRNA to standardize by the total number of bacteria in the sample. The final genes copy numbers were reported as per gram of dry soil using the bulk density of the soil as measured at the collection site at the sampling time (Rowell, 1997). The potential transformation of N2O to N2 was estimated as nosZI/(nirK+nirS) ratio.

Table 2. Genes, primers and conditions used in the microbial determinations.

*The G-C Clamp sequence CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGC CGTCAATTCMTTTGAGTTT, was attached to the 5, end of the primer. ** Touchdown (1°C/cycle).

2.4. Calibration curves

To discard detrimental effects of PCR inhibitors, calibration curves with several DNA dilutions were constructed for each gene under study and tested as in Cardenas et al. (2013). The amplicons of each gene were cloned in E. coli JM109 using pGEM®-T Easy Cloning Vector (Promega, USA) according to the manufacturer,s instructions. Plasmid DNA was purified using the PureYield™ Plasmid Miniprep System (Promega, USA) and its concentration was determined by spectrophotometry, as above. The presence of the inserts was verified by PCR with their specific primers and subsequent gel electrophoresis. The calibration curves since serial plasmid DNA showed a linear range between 106-1011 copy number, a R2>0.99 and the efficiency varied between 0.80-1.10.

2.5. Bacterial community analys

Denaturant Gradient Gel Electrophoresis (DGGE) analysis for bacterial 16S rRNA was performed using a Cipher DGGEK-2001 system (C.B.S. Scientific, USA) and a GC clamp sequence attached to the 5, end of the forward primer. Briefly, 17 µL of PCR product was loaded onto an 8% (w/v) polyacrilamide gel with a 40–80% gradient. The electrophoresis was run for 17 h at 100 V and the gel was stained with GelRed (Biotium Inc., USA) for 30 min and photographed on a UV transilluminator (UVP, USA). Representative bands with a high reproducibility in DGGE gels were identified using the Doc-ItLS analysis software (UVP) and carefully excised with a scalpel to ensure the extraction of representative information about bacterial diversity. The DNA was purified by the crush and soak protocol (Sambrook and Rusell, 2001) and a second round of amplification was performed to ensure that excised bands did not contain multiple bands. Then, the amplicons were sequenced (Macrogen, Inc., Korea) and the chromatograms retrieved were compared to reported sequences at the National Center for Biotechnology Information (NCBI) and analyzed with BioEdit 7.2.5 and BLAST (http://blast.ncbi.nlm.nih.gov/Blast.cgi) programs. Taxonomic identification was performed with RDP Classifier (http://rdp.cme.msu.edu/classifier/classifier.jsp) and EzTaxon server (http://www.ezbiocloud.net/eztaxon/identify) databases. The total diversity was determined using the Shannon-Weaver index (Zar, 1999).

2.6. Statistical analysis

The gene copy number data were analyzed by a one-way ANOVA using the Statistica 7.0 package and comparisons were carried out with Fisher test. Differences were considered to be significant when the p value was ≤0.05. The global relationship between gene abundances and the physicochemical soil parameters was performed using a multivariate generalized Procrustes analyses (Info-Gen) according to Gower (1975), and the relationship between SOM concentration and gene abundances was estimated using a lineal regression test. In both cases, JMP 10.0 was used as statistical package.

3. Results

3.1. Quantification of denitrifying genes

The quantification of denitrifying genes copy number showed that nosZI was the most abundant gene in all soils, followed by nirK and nirS (p<0.05; Table 3). For each gene, significant differences were found between soils. The abundance of nosZI was higher in andisoils (Nueva Braunau, Arrayán and Osorno) and lower in the ultisoil. For nirK the abundance was relatively inverse to nosZI with lower levels in Osorno and Nueva Braunau, and higher values in Collinco, Cudico and Arrayán soils (p<0.05; Table 3). The abundance of nirS gene was higher in Arrayán and Cudico, and lower in Osorno, Collinco and Nueva Braunau soils. In addition, the nosZI/nirK+nirS ratio was higher in andisoils (p<0.05; Table 3).

Table 3. Abundance of genes studied in volcanic ash soils (n=3). Data are showed as copy number g soil-1 ± standard error of the mean.

Different letters indicate significant differences between soils (p<0.05).

The Procraster analyses to relate gene abundances and the total physicochemical soil parameters show a high percentage of consensus (94.1%) whereas positive lineal relationships were found between SOM content and nosZI gene copy number (R2=0.691) and the nosZI/nirK+nirS ratio(R2=0.769).

3.2. Abundance and diversity of microorganisms

The abundance of the bacterial 16S rRNA gene varied between 3.45 x 109 and 4.55 x 109 copy number g-1, without significant differences among soils (p>0.05; Table 3). For Archaea, 16S rRNA abundancy ranged between 2.83 x 107 and 6.64 x 107 and was significantly lower than in bacteria (p<0.05). Differences among soils were observed between the Osorno and Nueva Braunau soil series containing lower abundancy whereas Cudico and Arrayán soils had higher contents (Table 3). Fungal 18S rRNA was lower than bacterial 16S rRNA and only showed a significant difference between Collinco and the others soils (p<0.05).

The DGGE analysis for bacterial 16S rRNA a high number of bands (>100), with different migration and intensities between soils (data not showed). We obtained a total of 57 DNA sequences that were taxonomically classified to the Class level. Initially, nine sequences were inconsistent with those reported at NCBI but successfully assigned after RDP and/or EzTaxon analysis. The taxonomic diversity in all analyzed soil series corresponded to nine phyla and 21 classes (Table 4). The most predominant phyla in whole soils were Firmicutes (33%), Acidobacteria (28%) and Proteobacteria (23%). Firmicutes was predominant in Cudico (57%), Osorno (46%) and Nueva Braunau (50%) soils, respectively, whereas Acidobacteria predominated in Collinco (58%, Figure 1). Proteobacteria predominated in the Arrayán soil (62%). Other phyla less represented were Actinobacteria, Bacteroidetes, Chloroflexi, Deinococcus-Thermus, Gemmatimonadetes and Calsiderica (Figure 1). The Shannon-Wiener index showed that the total diversity was low (H,<1.0) with similar values between soils (Table 5).

Table 4. Taxonomic identification of the DGGE bands.

*Sequences assigned using NCBI; **Sequences assigned using the EzTaxon database.

Figure 1. Phyla distribution of bacterial 16S rRNA in volcanic ash soils.

Table 5. Diversity of bacterial phyla of volcanic ash soils measured as Shannon-Wiener index. H, diversity index; H, max, maximum diversity index; E, evenness.

4. Discussion

In this study we performed qPCR to determine the abundance of denitrifying genes in different soil series currently used in agricultural or livestock activities in southern Chile. Our findings showed that nosZI gene was more abundant that nirK and nirS in all soils with similar values to several reports from around the world (Henry et al., 2006; Chronakova et al., 2009; Cardenas et al., 2013). In addition, andisoils showed a higher nosZI/nirK+nirS ratio compared to alfisoil and ultisoil. According to this, a high relationship was found between nosZI or the potential transformation of N2O to N2 (nosZI/nirK+nirS ratio) and SOM. These results suggest that during denitrification, most NO and N2O are reduced to N2 resulting in lower N2O emissions. This hypothesis is supported by the fact that denitrification have been defined as a poor-represented process in Chilean andisoils with lower N2O emissions compared to others reports (Vistoso et al., 2012). However, it has been reported that levels of N2O emissions could be uncoupled from genes abundance (Čuhel et al., 2010), so our results must be analyzed on a wider context. Furthermore, the study of transcripts or the real enzyme activities remain as significant areas to be investigated.

Denitrifiers had been traditionally classified into two functional and mutually exclusive groups, those carrying nirK or nirS genes, which uses Cu2+ and cytochrome cd1, respectively, as co-factors (Philippot et al., 2007). But recently the co-occurrence of both genes in microbial communities have been reported (Graf et al., 2014). Regarding N2O reductase, recent phylogeny studies have reported another gene coined nosZII which would have a significant contribution to N2O losses, being associated to a different clade (Clade II; Jones et al., 2012). This nosZII gene is very widespread and diverse, and more abundant than nosZI in bacteria and archaea. Preliminary results of our group show that bacterial nosZII is present in our soils and future studies are necessary to highlight and clarify the importance and function of this gene in volcanic ash soils. Recent reports indicate that both Archaea and Fungi have homologous and analogous enzymes to carry out the process of denitrification (Maeda et al., 2015; Rusch, 2013), becoming a component to consider in future studies to cover the total contribution of microorganisms.

Chilean volcanic ash soils have been characterized in a limited way in terms of microbiota and its relation to denitrifiers. Our results using 16S and 18S rRNA indicates that Bacteria domain predominated in all evaluated soils, whereas Archaea is higher than Fungi. The 16S rRNA have been the universal marker used to obtain and estimate total abundance of bacteria and archaea in different samples (Prévost-Bouré et al., 2014) including rhizosphere and bulk soil (Lagos et al. 2015). Despite being a multicopy gene in several species, its quantification is similar to rpoB, a new single copy marker, validating their use in environmental samples (Deslippe et al., 2014). In our study the copy number of bacterial 16S rRNA ranged between 3.45 x 108 to 4.55 x 108 being similar to another reports with soils showing a high SOM content (Kandeler et al. 2006; Cardenas et al. 2013). We found no significant differences between soils, despite the different physicochemical characteristics including SOM, pH or C/N ratio. These results suggest that in volcanic soils, the abundance of microorganisms could be linked to others factors like pH, water and oxygen content, organic C or the state of bioavailability of organic matter, regulating soil quality and plant nutrition (Čuhel et al., 2010; Barea, 2015). A similar trend was found for fungal 18S rRNA but with Collinco soil showing a higher abundance. For archaeal 16S rRNA, the pattern was more heterogeneous with andisoils showing the lower abundance. The gene copy number values reported here were similar to those reported by Cardenas et al. (2013) on similar soil types.

To assess the snapshot of the bacterial communities in our soils we performed DGGE assays, a molecular technique that is independent of culture and allows to study the diversity of communities (Muyzer et al, 1993). The pattern of bands obtained was different for each soil suggesting a differential composition. The sequence analysis only retrieved information to the Class level, and the total diversity measured as the Shannon-Weaver index was reduced probably because of the high taxonomic rank used in the allocation. This was presumably associated to the low number of DGGE bands isolated, which is recognized as the main limitation of the method. It is estimated that a single soil sample can generate a high number of bands (over 100 and more) corresponding to different communities (Nakatsu et al., 2007). Nonetheless, the information available allowed for the analysis of differences in the most represented phyla. Thus, the phyla with greater representation in the analyzed soils corresponded to Firmicutes, Acidobacteria and Proteobacteria, in agreement with Jorquera et al. (2010) in andisoil. While these phyla are considered significant for the denitrification process, specific phylogenetic studies are required for denitrifying genes because they are uncoupled of the proposed 16S rRNA evolution (Goregues et al., 2005). At the moment, we are performing DGGE using specific nosZI and nosZII primers.

Our results suggest than in volcanic soils of southern Chile, total denitrification can be expected under natural conditions which would explain the low N2O emissions registered for agricultural and grassland soils (Muñoz et al., 2011; Vistoso et al., 2012; Hube et al., 2016). Nevertheless, more studies including gene expression, enzyme activity and community structure of denitrifiers are required to link potential denitrification and the effect of soil macronutrients over N2O emissions. This knowledge will be also relevant to develop future mitigation strategies appropriate for specific soil characteristics.

5. Conclusions

Our results show that in our volcanic ash soils bacterial nosZI predominates between denitrifying genes. The high ratio of nosZI over nirK and nirS in Andisoils could suggest a higher denitrification potential. Compared to archaea and fungi, bacteria domain was most represented and includes Firmicutes, Acidobacteria and Proteobacteria classes, which have been implicated in soil denitrification. Further studies are necessary to understand soil N2O emissions and its mitigation.

Acknowledgments

This work was funded by the Fondo Nacional de Desarrollo Científico y Tecnológico (FONDECYT regular grant 1130718). We thank to Luis Ramírez and Sara Hube (INIA Remehue) for their assistance in soil sampling and physicochemical characterization, respectively, and Horacio Miranda for their assistance in statistical methods.

References

Alfaro, M., Salazar, F. 2008. Livestock production and diffuse pollution in a volcanic soil. J. Soil Sci. Plant Nutr. 8, 1-8.         [ Links ]

Armas-Ricard, M., Orlando, J., Bustamante, R., Carú, M. 2016. Microbial communities of bulk and Eschscholzia californica rhizosphere soils at two altitudes in Central Chile. J. Soil Sci. Plant Nutr. 16, 1-13        [ Links ]

Baker, G.C., Smith, J.J., Cowan, D.A. 2003. Review and re-analysis of domain-specific 16S primers. J. Microbiol Meth. 55, 541-555.         [ Links ]

Barea, J.M. 2015. Future challenges and perspectives for applying microbial biotechnology in sustainable agriculture based on a better understanding of plant-microbiome interactions. J. Soil Sci. Plant Nutr. 15, 261-282.         [ Links ]

Braker, G., Fesefeldt, A., Witzel, K., Braker, G., Fesefeldt, A. 1998. Development of PCR primer systems for amplification of nitrite reductase genes (nirK and nirS) to detect denitrifying bacteria in environmental samples. Am. Soc. Microbiol. 64, 3769-3775.         [ Links ]

Cardenas, L.M., Hatch, D.J., Scholefield, S., Jhurreea, D., Clark, L.M., Hirsch, P.R., Salazar, F., Rao-Ravella, S., Alfaro, M. 2013. Potential mineralization and nitrification in volcanic grassland soils in Chile. J. Soil Sci. Plant Nutr. 59, 1-12.         [ Links ]

Chroňáková, A., Radl, V. 2009. Overwintering management on upland pasture causes shifts in an abundance of denitrifying microbial communities, their activity and N2O reducing ability. Soil Biol. Biochem. 41, 1132-1138.         [ Links ]

CIREN. 2003. Descripciones de suelos, materiales y símbolos. Estudio Agrológico X Región. Vol. II. Centro de Información de Recursos Naturales (CIREN), Santiago.         [ Links ]

Čuhel, J., Šimek, M., Laughlin, R. J., Bru, D., Chèneby, D., Watson, C.J., Philippot, L. 2010. Insights into the effect of soil pH on N2O and N2 emissions and denitrifier community size and activity. Appl. Environ. Microbiol. 76, 1870-1878.

Deslippe, J.R., Jamali, H., Jha, N., Saggar, S. 2014. Denitrifier community size, structure and activity along a gradient of pasture to riparian soils. Soil Biol. Biochem. 71, 48-60.         [ Links ]

Escudey, M., Galindo, G., Förster, J. E., Briceño, M., Díaz, P., Chang, A. 2001. Chemical forms of phosphorus of volcanic ash-derived soils in Chile. Commun. Soil Sci. Plant Anal. 32, 601-616.         [ Links ]

Goregues, C.M., Michotey, V.D., Bonin, P. 2005. Molecular, biochemical and physiological approaches for understanding the ecology of denitrification. Microbiol. Ecol. 49, 198-208.         [ Links ]

Graf, D.R., Jones,M., Hallin, S. 2014. Intergenomic comparisons highlight modularity of the denitrification pathway and underpin the importance of community structure for N2O emissions. PLoS One. 9, e114118.         [ Links ]

Gower, J.C. 1975. Generalized procrustes analysis. Psychmetrika. 40, 33-51.         [ Links ]

Henry, S., Bru, D., Stres, B., Hallet, S., Philippot, L. 2006. Quantitative detection of the nosZ gene, encoding nitrous oxide reductase, and comparison of the abundances of 16S rRNA, narG, nirK, and nosZ genes in soils. Appl. Environ. Microbiol. 72, 5181-5199.         [ Links ]

Hube, S., Alfaro, M., Scheer, C., Brunk, C., Ramírez, L., Rowlings, D., Grace, P. 2016. Effect of a nitrification and urease inhibitors on nitrous oxide and methane emissions from an oat crop in a volcanic ash soil. Agric. Ecosyst. Environ. Accepted for publication.         [ Links ]

Jones, C.M., Graf, D.R.H., Bru, D., Philippot, L., Hallin, S. 2012. The unaccounted yet abundant nitrous oxide-reducing microbial community: a potential nitrous oxide sink. ISME J. 1-10.         [ Links ]

Jorquera, M.A., Hernández, M., Martínez, O., Marschner, P., Mora, M. 2010. Detection of aluminium tolerance plasmids and microbial diversity in the rhizosphere of plants grown in acidic volcanic soil. Eur. J. Soil Biol. 46, 255-263.         [ Links ]

Kandeler, E., Deiglmayr, K., Tscherko, D., Bru, D., Philippot, L. 2006. Abundance of narG, nirS, nirK, and nosZ genes of denitrifying bacteria during primary successions of a glacier foreland. Appl. Environ. Microbiol. 72, 5957-5962.         [ Links ]

Lagos, M.L., Maruyana, F., Nannipieri, P., Mora, M.L., Ogram, A., Jorquera, M.A. 2015. Current overview on the study of bacteria in the rhizosphere by modern molecular techniques: a mini‒review. J. Soil Sci. Plant Nutr. 15, 504-523.         [ Links ]

Lobos Ortega, I., Alfaro, M., Martínez-Lagos, J. 2016. Soil nitrogen contribution to grasslands and its implication for nitrogen use efficiency. J. Soil Sci. Plant Nutr. 16(2), 420-432.         [ Links ]

Maeda, K., Spor, A., Edel-Hermann, V., Heraud, C., Breuil, M.C., Bizourd, F., Toyoda, S., Yoshida, N., Steinberg, C., Philippot, L. 2015. N2O production, a widespread trait in fungi. Sci. Rep. 5, 9697.         [ Links ]

Michotey, V., Mejean, V., Bonin, P. 2000. Comparison of methods for quantification of cytochrome cd1-denitrifying bacteria in environmental Marine Samples. App. Environ. Microbiol. 66, 1564-1571.         [ Links ]

Muñoz, C., Paulino, L., Vera, J., Zagal, E. 2011. CO2 and N2O emissions from an andisol in Chile under a NO-till system using non-fixed closed chambers. Chilean J. Agric. Res. 71, 275-282.         [ Links ]

Muyzer, G., de Waal, E.C., Uitterlinden, A.G. 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl. Environ. Microbiol. 59, 695-700.         [ Links ]

Nakatsu, C.H. 2007. Soil microbial community analysis using denaturing gradient gel electrophoresis. Soil Sci. Soc. Am. J. 71, 562.         [ Links ]

Philippot, L., Hallin, S., Schloter, M. 2007. Ecology of denitrifying prokaryotes in agricultural soil. Advances in Agronomy. 96, 249-305.         [ Links ]

Prévost-Bouré, N.C., Christen, R., Dequiedt, S., Mougel, C., Lelièvre, M., Jolivet, C., Shahbazkia, H.R., Guillou, L., Arrouays, D., Ranjard, L. 2011. Validation and application of a PCR primer set to quantify fungal communities in the soil environment by real-time quantitative PCR. PLoS One. 6, e24166.         [ Links ]

Rowell, D.L. 1997. Soil science: Methods and Applications. Addison Wesley Longman Limited, Essex, pp: 79-108.         [ Links ]

Rusch, A. 2013. Molecular Tools for the detection of nitrogen cycling Archaea. Archaea. 2013, 1-10.         [ Links ]

Sadzawka, A., Carrasco, M.A., Demanet, R., Flores, H., Grez, R., Mora, M.L., Neaman, A. 2007. Métodos de análisis de tejidos vegetales. 2a ed. Serie Actas N°40. Instituto de Investigaciones Agropecuarias INIA, Santiago, 139 p.         [ Links ]

Sambrook, J., Rusell, D.W. 2001. Molecular cloning: A laboratory manual. 3rd ed. Cold Spring Harbor Laboratory Press, New York, NY, pp: 127-128.         [ Links ]

Thomson, A.J., Giannopoulos, G., Pretty, J., Baggs, E.M., Richardson, D.J. 2012. Biological sources and sinks of nitrous oxide and strategies to mitigate emissions. Philos. Trans. R Soc. B Biol. Sci. 367, 1157-1168.         [ Links ]

Throbäck, I.N., Enwall, K., Jarvis, A., Hallin, S. 2004. Reassessing PCR primers targeting nirS, nirK and nosZ genes for community surveys of denitrifying bacteria with DGGE. FEMS Microbiol. Ecol. 49, 401-417.         [ Links ]

Vainio, E.J., Hantula, J. 2000. Direct analysis of wood-inhabiting fungi using denaturing gradient gel electrophoresis of amplified ribosomal DNA. Mycol. Res. 104, 927-936.         [ Links ]

Vistoso, E., Alfaro, M., Saggar, S., Salazar, F. 2012. Effect of nitrogen inhibitors on nitrous oxide emissions and pasture growth after an autumn application in volcanic soil. Chil. J. Agric. Res. 72, 133-139.         [ Links ]

Zar, J.H. 1999. Biostatistical Analysis. 4th Ed. Prentice Hall, New Jersey, 663 p.         [ Links ]

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons